Kerala Gazette No. 8 dated 24th February 2009.

PART III

STORES PURCHASE

Gaz. No. 8/2009/DTP (Stores).

Agriculture Department

Z¿Lmkv ]ckyw

\º¿ F.C.(2) 578/2008.

2009 P\phcn 27.

tIcf Kh¿Æ¿°pth≠n sIm√w Irjn AknÃ‚ v

FIvknIyq´ohv F©n\ob¿, sIm´mc°c Iipamhn≥

tXm´Øn\v th≠n Xmsg ]dbp∂ Im¿jnI D]IcWßƒ

hmßp∂Xn\v AwKoIrX GP≥knIfn¬ \n∂pw a¬kc

kz`mhap≈ Z¿LmkpIƒ ap{Zh® IhdpIfn¬

£Wn®psIm≈p∂p.

Ihdns‚ ]pdØv ‘Im¿jnI D]IcWßfpsS

hnXcWw’ F∂v FgpXnbncnt°≠XmWv.

Z¿LmkpIƒ

28˛2˛2009 sshIpt∂cw 3 aWnhsc Cu Hm^okn¬

kzoIcn°p∂Xpw At∂ Znhkw sshIpt∂cw 3.30˛\v

lmPcp≈

IcmdpImcptStbm

Ah¿

tcJmaqew

A[nImcs∏SpØp∂ GP‚pamcptStbm km∂n≤yØn¬

Xpd°p∂Xpw G‰hpw Ipd™ \nc°v tcJs∏SpØnb

Bfns‚ t]cn¬ ÿncs∏SpØp∂XpamWv.

{Ia

C\w

Afhv

\º¿

(1)

(2)

(3)

3 F®v.]n. s]t{Smƒ˛asÆÆ t]m¿´_nƒ

1 FÆw

]ºv sk‰pw A\p_‘ kma{KnIfpw

an\n saXnb{¥w 0.5 F®v.]n. tamt´m¿

klnXw

UnPn‰¬ tambvkvN¿ ao‰¿, Iw]yq´¿ ^n‰nwKv

klnXw

sNbn≥km 2.5 F®v.]n., 4 sI.Pn. 450 Fw.Fw. 1

kvt]m°‰v t\mkv ssS∏v

tdm´dn Sn√¿ (2.1 F®v.]n. 8000 B¿.]n.Fw.

1 FÆw

21 sI.Pn. s]t{Smƒ F≥Pn≥)

{Km^v‰nwKv IØn

kn˛7, 2 kv{Sm°v kvt{]b¿

tdm°¿ kvt{]b¿

\m∏v km°v kvt{]b¿

1 C©v ^vsfkvIv tlmkv

150 ao‰¿

1.5 C©v

150 ao‰¿

ho¬_mtcm

2 FÆw

t]m¿´_nƒ P\td‰¿ sk‰v 1.5 sI.hn.F.

\nc-X-{Z-hyw—2.5%.

Z¿Lm-kv t^m-d-Øns‚ hne—cq] 600 + hm‰v.

Z¿LmkpIƒ ÿncs∏SpØn In´p∂bmƒ Cu

B^okn¬ \n∂pw hnXcW DØchv In´n 7 ZnhkØn\Iw

50 cq] ap{Z∏{XØn¬ Bhiyamb F{Knsa‚ v ka¿∏n

t°≠XmWv.

Izt´j\pIƒ°v k¿°m¿ \n›bn®n´p≈

F√m am\ZWvUßfpw CXn\pw _m[Iambncn°pw.

Irjn AknÃ‚ v FIvknIyq´ohv

(H-∏v)

F©n\obdpsS Imcymebw,

AknÃ‚ v FIvknIyq´ohv

sIm√w.

F©n\ob¿ (Irjn).

Animal Husbandry Department

TENDER NOTICES

[12/2008-09]

(1)

No. G3-12826/2008/AHD.

15th January 2009.

Sealed and competitive tenders are invited under “Two cover system” for the supply of Veterinary Medicines

(Common and Patent) for the use of Various Veterinary Institutions of Animal Husbandry Department for the year 2008-09.

First Cover (Cover A-Technical) will have the following enclosures :

List of Medicines intended to be quoted with specification and without rates.

GMP Certificate in accordance with (1) “Revised schedule M of Drugs and Cosmetics Rules 1945” (Current GMP) or

(2) WHO GMP Certificate. Only these certificates will be accepted.

Certificate from Licensing Authority/Drugs Controller to prove minimum 3 years of market standing of the product.

(1)

(2)

(3)

Attested copy of license or certificate of renewal and the list of drugs. Tenderers should be original manufacturers

of the quoted item. Items manufactured on loan license or purchased from other sources will not be accepted

except for imported items.

Non-Conviction Certificate from the Drugs Controller.

Latest Annual Accounts of statement audited by a Chartered Accountant.

Sales Tax Clearance Certificate from concerned authorities.

Attested copy of Memorandum and articles of Association or partnership deed.

An affidavit in stamp paper worth Rs. 50 notorized by a Notary Public of either the place where the person making

the affidavit is residing or of Thiruvananthapuram signed by the owner of the firm.

All documents furnished should be attested by a Gazetted Officer or Notary.

Second Cover (Cover B-Financial) will have the following enclosures :

Quoted rates for each drug (inclusive of Tax).

Original tender form duly signed by authorized signatory.

Preliminary agreement in Kerala Stamp Paper worth Rs. 50.

EMD (1% of the total cost of medicines quoted) by means of demand draft drawn in favour of Director of Animal

Husbandry, Kerala payable at Thiruvananthapuram.

Both covers (A & B) must be effectively sealed and put in another cover, which is also sealed and submitted. Cover

A and B will be opened as per the schedule given below. Cover ‘B’ of those tenderers who satisfy the above conditions

in Cover ‘A’ will only be opened. The cover B of rejected tenders will be returned without opening on finalization of

purchase procedure. Details of medicines to be supplied can be had from the tender form and Government of Kerala

Website www.kerala.gov.in. Intending tenderers may send the exact amount towards the cost of tender form. Cheques,

Postage Stamps, Postal Orders, Demand Drafts etc. will not be accepted as the cost of tender form nor the form be sent by

Value Payable Post. Tender form can also be obtained from the Office of the Director of Animal Husbandry on payment

of the cost in cash during Office hours. Late tenders will not be considered under any circumstances. Tenders should be

superscribed as “Tender No. 12/2008-09 for the Supply of Veterinary Medicines (Common and Patent) for the use of the

Animal Husbandry Department, Kerala for the Year 2008-09”.

Price of tender form :

Original—Rs. 25,000 + VAT @ 12.5%.

Duplicate—Rs. 12,500 + VAT @ 12.5%.

Last date and time for sale of tender forms—25-2-2009, 4 p. m.

Due date and time for receipt of tenders (Cover A and B)—26-2-2009, 4 p. m.

Date and time for opening of Cover A—27-2-2009, 10.30 a. m.

Date and time of publishing list of tenderers eligible for opening their Cover B—27-2-2009, 1 p. m.

Date and time for opening of Cover B—27-2-2009, 2 p. m.

Date upto which the rates are to be firm for acceptance—31-3-2009.

Designation and address of the Officer from whom the tender forms are to be obtained and to whom the tenders

are to be submitted—The Director, Animal Husbandry Department, Vikas Bhavan P. O., Box No. 5403,

Thiruvananthapuram-695 033.

LIST OF MEDICINES

Common Drugs

Acid Benzoic

500 gm.

Acid Benzoic I.P.-500 gm.

6000

Acid Boric

500 gm.

Acid Boric I.P. 500 gm.

20500

Acid Salicylic

500 gm.

Acid Salicylic I.P. 500 gm.

10000

Acriflavin

100 gm.

2000

Ammo. Carb

500 gm.

Acid Salicylic I.P. 500 gm.

10000

Bismuth Carb

500 gm.

Bismuth Carb I.P. 500 gm.

1000

Calcium Gluconate

500 gm.

Calcium Gluconate I.P. 500 gm.

400

Copper Sulphate

500 gm.

Copper Sulphate 500 gm.

2000

Creta preparata

1 kg.

40000

Formalin

500 ml.

Formalin B.P. 500 ml.

7000

Glycerine

500 ml.

Glycerine I.P. 500 ml.

12000

Light Kaolin

1 kg.

Light Kaolin I.P. 1 kg.

30000

Light Liquid Paraffin

500 ml.

Light Liquid Paraffin I.P. 500 ml.

5000

Lint. Camphor

500 ml.

5000

Lint. Turpentine

500 ml.

Lint. Turpentine 500 ml.

3056

Mag. Sulph

25 kg.

Mag. Sulph 25 kg.

1000

Mag. Carb.

500 ml.

Mag. Carb. 500 gm.

15000

Oil Turpentine

500 ml.

Oil Turpentine 500 ml.

15000

Ol. Piscis Liquidum

500 ml.

10000

Paraffin mole album

5 kg.

Phenyl Lotion Gr. III

5 lit.

7000

Piperazine Hexahydrate Liquid 45%

500 ml.

6000

Potassium Permanganate

500 gm.

Potassium Permanganate I.P. 500 gm.

80000

Pulv. Ajown

2 kg.

Pulv. Ajown 2 kg.

10000

Pulv. Chiretta

2 kg.

Pulv. Chiretta 2 kg.

7000

Pulv. Zingiberris

2 kg.

Pulv. Zingiberris 2 kg.

10000

Soda salicylate

500 gm.

Sodium salicylate I.P. 500 gm.

20000

Sodabicarb

1 kg.

Sodabicarb I.P. 1 kg.

25000

Sulphur sublimatum

500 ml.

Sublimed Sulphur 500 gm.

15000

Tr. Asafoetida

500 ml.

Tr. Asafoetida 500 ml.

15000

Tr. Benzoin

500 ml.

Compund Benzoin Tincture I.P. 500ml.

6053

Tr. Cardamom

500 ml.

Tr. Cardamom B.P. 500 ml.

15000

Tr. Catechu

500 ml.

Tr. Catechu B.P. Vet 500 ml.

15000

Tr. Gentian

500 ml.

Tr. Gentian B.P. 500 ml.

15000

Tr. Iodine

500 ml.

16000

Tr. Opium

500 ml.

Tr. Opium B.P. 500 m.

Zinc Oxide

500 gm.

Zinc Oxide I.P. 500 gm.

6053

Patent Drugs

Adrenaline inj.

1 ml.

Each ml. contains Adrenaline acid tartarate 180 mcg/

0.1 ml. equivalent to 1:1000 adrenaline

Adrenochrome inj.

10 ml.

Adrenochrome 10 ml. injection each ml. containing

4000

Carbasochrome salicylate equivalent to Adrenochrome

monosemicarbazone 10 mg, benzyl alcohol I.P.

(as preservative) 2.5% w/v

Albendazole 300 mg + Praziquintal

Albendazole 300 mg + Praziquintal 25 mg. tablet each 200000

25 mg. tablet

tablet containing 300 mg. Albendazole and Praziquintal

25 mg.

Albendazole bolus

600 mg.

Albendazole 600 mg. bolus each bolus containing

1900

Albendazole 600 mg.

Albendazole Bolus

1.5 gm.

Albendazole 1.5 gm. bolus each bolus containing

1500

Albendazole 1.5 gm.

Albendazole Suspension 2.5%

1 litre

Albendazole 1 litre suspension containing Albendazole

3000

2.5 % W/V.

Amikacin inj. 250 mg/2ml.

2 ml.

Each vial containing Amikacin sulphate 250 mg. I.P.

29000

Amitraz Liq

250 ml.

Amitraz 250 ml. Liquid each ml. containing 50 mg. 10000

Amitraz B.P. W/V.

Amoxycillin cloxacillin inj.

500 mg.

Each vial containing Amoxicillin Sodium 250 mg. and

29000

Cloxacillin 250 gm. I.P.

Amoxycillin cloxacillin inj.

3 gm.

Each vial containing Amoxicillin Sodium 1.5 gm. and

650

Cloxacillin sodium 1.5 gm.

Amprolium

100 gm.

Amprolium hydrochloride + Vit K 500 gm. powder

1375

containing Amprolium hydrochloride I.P. 20% w/w,

Vit K I.P. 2% w/w

Antimony Potassium Tartarate +

Antimony Potassium Tartarate + Ferrous Sulph + Copper

900

Ferrous Sulph + Copper Sulph +

Sulph + Cobaltus Chlor Bolus Each bolus containing

Cobaltus Chlor Bolus

Antimony Potassium Tartrate 2 gm. Ferrous Sulphate

2 gm. Copper sulphate 50 mg. and cobalt chloride 100 mg.

Atropine Sulphate inj.

1 ml.

Atropine Sulphate 1 ml. injection each ml. containing

10000

1mg. of atropine sulphate I.P.

B1 + B6 + B12 Inj.

3 ml/10ml.

40000

Betamethasone inj.

2 ml.

Betamethasone 2ml. injection each ml. containing

50000

Betamethasone Sodium Phopshate I.P. equivalent to

Betamethasone 4 mg.

Calcium Boro Gluconate inj.

450 ml.

Calcium Boro Gluconate 450 ml. injection containing

50000

Calcium Boro Gluconate 25% w/v B.P.

Calcium Mangnesium Boro

450 ml.

Calcium Mangnesium Boro Gluconate 450 ml. injection

Gluconate inj.

containing Calcium Gluconate 20.75% w/v, Boric

acid 4.2% w/v, Mangnesium hypophosphate 5.5 w/v,

Dextrose unhydrous 20% w/v

Chloromphenicol sod. succinate inj.

1 gm.

Chloromphenicol sod. succinate 1 gm. injection each vial

59000

contains Chloramphenicol Sodium Succinate I.P.

equivalent to 1 gm. of Chloramphenicol

Chlorpheneramine maleate Inj.

30 ml.

Chloraphenramine Maleate 30 ml. Injection each ml.

10000

contains 10 mg. of Phenramine maleate I.P.

Cypermethrin solution

1 litre

Cypermethrin solution containing cypermethrin

2000

100 mg/ml.

Dexamethsone inj.

10 ml.

Dexamethsone 10 ml. injection each ml. containing

130

Dexamethsone sodium phopshate I.P. equivalent to

Dexamethsone 4 mg.

Dextrose inj. 25%

540 ml.

Dextrose 25% 540 ml. injection containing Dextrose

50000

I.P. 25% w/v

Dextrose inj. 10%

540 ml.

Dextrose 10% 540 ml. injection containing Dextrose

370

I.P. 10% w/v

Dextrose Normal Saline inj.

540 ml.

Dextrose Normal Saline 540 ml. injection containing

100000

0.9 % w/v sodium chloride and 5% w/v Dextrose

Diaminazene Aceturate

5 gm.

Granules containing 4, 4 Diamidino diazoamin-

7000

nobenzenediacceturate in amber coloured bottle

Distilled water

10 ml. vial

80000

(plastic vials)

Doxycycline + Neomycin powder

100 gm.

Each gm. containing Doxycycline hydrochloride I.P.

7000

(100 mg + 100 mg.)

100 mg. and Neomycin sulphate I.P. 100 mg.

Enrofloxacin 10% inj.

30 ml.

Enrofloxacin 10% 30 ml. injection each ml. containing

90000

enrofloxacin 100 mg.

Enrofloxacin 10% Oral liquid

1 litre

Enrofloxacin 10% 1 litre Oral solution each ml. contains

1000

enrofloxacin 100 mg./ml.

Fenbendazole bolus

150 mg.

Fenbendazole 150 mg. bolus each tab should contain

350000

150 mg. of Fenbendazole

Gamma BHC + Proflavin spray

Gamma BHC + Proflavin Cetrimide 100 gm. ointment

355

Containing 0.1% of pure Gamma isomer of benzene

hexachloride, 0.1% Proflavin hemisulphate and 0.45%

Cetrimide I.P.

Gentamycin 40 mg/ml inj.

30 ml.

Gentamycin 30 ml. injection each ml. contains

90000

Gentamycin 40 mg. as gentamycin sulphate I.P.

Gn RH Inj.

10 ml.

Gn RH inj. each ml. containg Brusalin acetate 0.0042

20000

equivalent to Brusalin 0.004 mg.

Iodine methyl salicytae ointment

500 gm.

containing Iodine 4% w/w & methyp salicylate

10000

5% w/v

Ivermectin Inj.

7 ml.

Ivermectin 7 ml. Injection containing Ivermectin

10000

1% w/v

Lignocaine inj.

30 ml.

Lignocaine 30 ml. Injection containing Lignocaine

7000

HCL I.P. 2%

Meloxicam Inj.

30 ml.

Meloxicam 30 ml. injection each ml. containing

40000

meloxicam BP 5 mg.

Metronidazole inj.

100 ml.

Metronidazole 100 ml. injection each ml. contains

30000

Metronidazole I. P. 5 mg

Nitrofurazone, Metranidazole + Urea

Nitrofurazone, Metranidazole + Urea Pessary

375

Obstetrical cream

500 gm.

10000

Oxy Tetracycline DS inj.

30 ml.

Oxy Tetracycline DS 30 ml. injection each ml. containing

48000

Oxytetra cycline hydrochloride I.P. 100 mg.

Oxytocin inj.

1 ml.

Each 0.5 ml. containing 5 units of Oxytocin I. P.

10000

Piperazine Hexahydrate Liquid 45%

500 ml.

Containing Piperazine Hexahydrate 45% w/v

330

Prednisolone 10 mg./ml. inj.

10 ml.

Prednisolone 10 ml. Injection each ml. containing 10 mg.

of Prednisolone

Pyrantel Palmoate

10 ml.

Pyrantel Pamoate 10 ml. liquid Each ml. containing 50 mg. 60000

Pyrantel pamoate

Gaz. No. 8/2009/DTP (Stores).

Strepto Pencillin inj.

2.5 gm.

Strepto Pencillin inj. 2.5 gm. should contain Sreptomycin 70000

sulphate 2.5 gm. Procaine pencillin 15 lakhs unit &

Pencillin G Sodium 5 lakh unit

Xylazine HCL inj.

5 ml.

Xylazine HCI 5 ml. injection each ml. containing

10000

Xylazine Hyrochloride B. P. 23.332 mg. equivalent to

20 mg. of Xylazine

SPECIAL CONDITIONS

The medicine should be of latest standards and should have minimum 75% shelf life left under normal storage

condition at the time of supply.

The rates quoted should be inclusive of all taxes.

All offers should be from ready stock in the oringinal packing of the manufacturer.

The

samples

all

items

supplied

after

effecting

supply

will

get

tested

through

Drug Controller, Thiruvananthapuram. The supplier should bear the expenditure for testing of the drugs.

75% of payment will be effected at an early date from the date of acceptance of the consignment by the

Departmental stores subject to the availability of funds and priority of supplies. The balance 25% of payment will

be released only after getting the test results.

Packing and containers of drugs shall be as prescribed in Pharmacopeias or Drugs and Cosmetic

Rules 1945. Containers made of good plastic must be used for those items which are to be supplied in plastic

containers.

The Security Deposit furnished will be released only after satisfactory completion of the contract.

The rates should be for delivery F.O.R. at any part of the State.

Ex-godown rates and F.O.R. station of despatch rates offered by the firms are not acceptable and such tenders will

be summarily rejected.

10.

On the label of each packing it should be inscribed “For the use of Animal Husbandry Department, Kerala”.

11.

The quantities specified in the schedule are only approximate and they may vary according to actual need.

12.

Successful tenderers should supply the items at the approved rates and conditions to the local self Governments and

other Departmental Institutions as per their request.

13.

The successful tenderers should complete all supplies with in the stipulated time stated in the supply orders.

14.

The non-availabilty of raw materials, price hike of raw materials, transporation problems etc. will not be accepted as

reasons for non-supply or late supply.

15.

The rates should be quoted in Indian Currency and payment will be made in Indian Currency only.

16.

The successful tenderers should produce analytical report of every batch of medicine they have supplied, to the

Controlling Officer of the destination, at the time of the supply and send a copy to the Director of

Animal Husbandry.

17.

The Director of Animal Husbandry reserves all rights to cancel the tender without assigning any reason thereof.

18.

The Director of Animal Husbandry on his authority has the right to inspect the manufacturing unit.

19.

The only jurisdiction for any dispute regarding this purchase will be at Thiruvananthapuram.

20.

The photocopies of the documents produced along with the tender should be attested by a Gazetted Officer or a

Notary.

21.

If any of the date scheduled for receipt and opening of tender is declared as holiday, (local or general), the receipt

and opening will be on the next working day at the same time.

22.

Name and place to which the medicines are to be supplied :

Three Central Veterinary Stores at Thiruvananthapuram, Thrissur and Kozhikode however the tenderer should

be ready to be supplied to any part of the State.

23.

The Director of Animal Husbandry reserves the right to delete, waive any of the above special conditions or

cancel the whole tender.

24.

The Supply should be effected only by the original tenderer and the invoice should also be furnished only by them.

(2)

[25/2008-09]

No. G3-17326/08/AHD.

17th January 2009.

Sealed and competitive tenders are invited under

“Two cover system” for the supply of 2,00,000 doses

(20,000 x 10 ml.) of Tissue Culture Anti-rabies Vaccine for

the use of Various Veterinary Institutions of Animal

Husbandry Department for the year 2008-09.

First Cover (Cover A-Technical) will have the following

enclosures:

Details of vaccine intended to be quoted with

specification and without rates.

GMP Certificate in accordance with (1) “Revised

Schedule M of Drugs and Cosmetics Rules 1945”

(Current GMP) or (2) WHO GMP Certificate. Only

these certificates will be accepted.

Certificate from Licensing Authority/Drugs

Controller to prove minimum 3 years of market

standing of the product.

Attested copy of licence or certificate of renewal

and the list of drugs. Tenderers should be original

manufacturers of the quoted item. Items

manufactured on loan licence or purchased from

other sources will not be accepted except for

imported items.

Non-Conviction Certificate from the Drugs

Controller.

Latest Annual Accounts of statement audited by a

Chartered Accountant.

Sales Tax Clearance certificate from concerned

authorities.

Attested copy of Memorandum and articles of

Association or partnership deed.

An affidavit in stamp paper worth Rs. 50 notorized by

a Notary Public of either the place where the person

making the

affidavit is residing or of

Thiruvananthapuram signed by the owner of the firm.

10.

All documents furnished should be attested by a

Gazetted Officer or Notary.

Second Cover (Cover B-financial) will have the following

enclosures:

Quoted rates of the vaccine (Inclusive of Tax).

Original tender form duly signed by authorized

signatory.

Preliminary agreement in Kerala Stamp Paper worth

Rs. 50.

EMD (1% of the total cost of medicines quoted) by

means of demand draft drawn in favour of Director

of Animal Husbandry, Kerala, payable at

Thiruvananthapuram.

Price of tender form :

Original—Rs. 3,000 + VAT @ 12.5%.

Duplicate—Rs. 1,500 + VAT @ 12.5%.

Last date and time for sale of tender forms—

26-2-2009, 4 p. m.

Due date and time for receipt of tenders (Cover A

and B)—27-2-2009, 4 p. m.

Date and time for opening of Cover A—28-2-2009,

10.30 a. m.

Date and time of publishing list of tenderers eligible

for opening their Cover B—28-2-2009, 1 p. m.

Date and time for opening of Cover B—28-2-2009,

2 p. m.

Date upto which the rates are to be firm for

acceptance—31-3-2009.

Designation and address of the Officer from whom

the tender forms are to be obtained and to whom the

tenders are to be submitted—The Director, Animal

Husbandry Department, Vikas Bhavan, P. O. Box

No. 5403, Thiruvananthapuram-695 033.

Both covers (A & B) must be effectively sealed and

put in another cover, which is also sealed and submitted.

Cover A and B will be opened as above. Cover ‘B’ of

those tenderers who satisfy the above conditions in Cover

‘A’ will only be opened. The cover B of rejected tenders

will be returned without opening on finalization of

purchase procedure. Details of vaccine to be supplied can

be had from the tender form and Government of Kerala

Website-www.kerala.gov.in. Intending tenderers may send

the exact amount towards the cost of tender form.

Cheques, Postage Stamps, Postal Orders, Demand Drafts

etc. will not be accepted as the cost of tender form nor

the form be sent by Value Payable Post. Tender form can

also be obtained from the Office of the Director of Animal

Husbandry on payment of the cost in cash during office

hours. Late tenders will not be considered under any

circumstances. Tenders should be superscribed as

“Tender No. 25/2008-09 for the Supply of Tissue Culture

Anti-Rabies Vaccine for the use of the Animal Husbandry

Department, Kerala for the Year 2008-09”.

SPECIAL CONDITIONS

The vaccine should be of latest standards and

should have minimum 75% shelf life left under

normal storage condition at the time of supply.

The rates quoted should be inclusive of all taxes.

All offers should be from ready stock in the

oringinal packing of the manufacturer.

Packing and containers of drugs shall be as

prescribed in pharmacopeias or Drugs and Cosmetics

Rules 1945. Containers made of good plastics must

be used for those items which are to be supplied

in plastic containers.

The Security Deposit furnished will be released

only after satisfactory completion of the contract.

The rates should be for delivery F.O.R. at any part

of the State.

Ex-godown rates and F.O.R. station of despatch

rates offered by the firms are not acceptable and

such tenders will be summarily rejected.

On the label of each packing it should be inscribed

“For the use of Animal Husbandry Department,

Kerala”.

The quantities specified in the schedule are only

approximate and they may vary according to actual

need.

10.

Successful tenderers should supply the items at the

approved rates and conditions to the Local Self

Governments and other Departmental Institutions as

per their request.

11.

The successful tenderers should complete all

supplies with in the stipulated time stated in the

supply orders.

12.

The non-availabilty of raw materials, price hike of

raw materials, transportion problems etc. will not be

accepted as reasons for non- supply or late supply.

13.

The rates should be quoted in Indian Currency

and payment will be made in Indian Currency only.

14.

The successful tenderers should produce analytical

report of every batch of vaccine they have

supplied, to the Controlling Officer of the

destination, at the time of the supply and send a

copy to the Director of Animal Husbandry.

15.

The Director of Animal Husbandry reserves all

rights to cancel the tender without assigning any

reason thereof.

16.

The Director of Animal Husbandry on his authority

has the right to inspect the manufacturing unit.

17.

The only jurisdiction for any dispute regarding this

purchase will be at Thiruvananthapuram.

18.

The photocopies of the documents produced along

with the tender should be attested by a Gazetted

Officer or a Notary.

19.

If any of the dates scheduled for receipt and

opening of tenders is declared as holiday (local or

general), the receipt and opening will be on the

next working day at the same time.

20.

Name and place to which the vaccine is to be

supplied:

Three

Central

Veterinary

Stores

Thiruvananthapuram, Thrissur and Kozhikode

however the tenderer should be ready to

be supplied to any part of the State.

21.

The Director of Animal Husbandry reserves the

right to delete, waive any of the above special

conditions or cancel the whole tender.

22.

The Supply should be effected only by the original

tenderer and the invoice should also be furnished

only by them.

23.

Sample should be furnished along with tender.

(3)

[26/2008-09]

No. G1-2785/08/St.

30th January 2009.

Sealed and competitive tenders are invited from the

manufacturers/authorised suppliers for the supply of Ultra

Sound Scanner for the use of District Veterinary Centre,

Thiruvananthapuram for the year 2008-09.

Specification of the item with rate and list of

institutions where it has been supplied and

installed.

Letter from original manufacturer (in case of agents)

regarding assurance about supply of spare parts,

AMC conditions ( Period of visits in a year etc.),

warranty conditions, years of warranty, brochures etc.

An affidavit in stamp paper worth Rs. 50 notarized

by a Notary Public of either the place where the

person making the affidavit is residing or of

Thiruvananthapuram.

Copy of ISO Certification, if any.

Original tender form duly signed by authorized

signatory.

Preliminary agreement in Kerala Stamp Paper worth

Rs. 50.

EMD 1% of the total cost of items quoted by

means of demand draft drawn in favour of Director

of Animal Husbandry, Kerala, payable at

Thiruvananthapuram.

Details of equipment to be supplied can be had along

with the tender form, Government of Kerala Website-

www.kerala.gov.in and the Department Website-

ahdkerala.gov.in.

Intending tenderers may send the exact

amount towards the cost of tender form. Cheques,

Postage Stamps, Postal Orders, Demand Drafts etc. will not

be accepted as the cost of tender form nor the form be

sent by Value Payable Post. Tender form can be obtained

from the Office of the Director of Animal Husbandry on

payment of the cost in cash during office hours. Late

tenders will not be considered under any circumstances.

Tenders should be superscribed as “Tender No. 26/2008-09

for the Supply of Ultra Sound Scanner for the use of

District Veterinary Centre, Trivandrum, for the Year

2008-09”.

Price of tender form :

Original—Rs. 2,300 + VAT @ 12.5%.

Duplicate—Rs. 1,200 + VAT @ 12.5%.

Last date and time for sale of tender forms—

2-3-2009, 4 p. m.

Due date and time for receipt of tender—3-3-2009,

11 a. m.

Date and time for opening of tender—3-3-2009, 4 p.m.

Date upto which the rates are to be firm for

acceptance—31-3-2009.

Designation and address of the Officer from whom

the tender forms are to be obtained and to whom the

tenders are to be submitted—The Director, Animal

Husbandry Department, Vikas Bhavan, P. O. Box

No. 5403, Thiruvananthapuram-695 033.

SPECIFICATION

Dedicated Veterinary High Performance, Premium,

Professional, Efficient, Ergonomic Colordoppler Ultrasound

Diagnostic System with

High Resolution 15” CRT monitor

Pulse Wave Doppler

HPRF

Color Doppler Flow Imaging

Regional Acoustic Zoom

Power Doppler Flow Imaging

Directional Power Doppler Flow Imaging

Tissue harmonic Imaging

Trapezoidal Imaging

i Touch TM automatic image optimization

80GB hard disk

CD-R/W and USB ports

Measurement & calculation software packages

(Veterinary)

User- define key board

Standard 3 probe connectivity

Non windows based OS

AVI/CIN format cine, M/PW cine save, editable cine

Total power consumption should be less than 1 Kva.

Convex array transducer (2.5/3.5/5.0/H4.6/H6.0MHZ)

Transrectal (side firing) transducer (5.0/6.5/8.0MHz)

Ups with a backup of 30 min.

CONDITIONS

Offers should be from the manufacturers/suppliers

of the items quoted and with original

specifications, make models etc.

All successful tenderers should complete all the

supplies within the stipulated time as mentioned in

the supply order.

No extension of time will be

granted beyond this under any.

The leaflets, illustrated catalogue if any of the

equipment/instrument quoted shall be sent along

with the tender.

Equipments supplied should have a minimum

warranty period of 1 year.

The prices quoted should be inclusive of all taxes,

duties, cesses etc.

The rates should be quoted in Indian currency for

the units specified against the items and the

payment will be made in Indian currency only.

Offers of conditional supply to the department will

not be considered.

The rates should be for delivery at the District

Veterinary Centre, Thiruvananthapuram.

Ex-godown rates and F.O.R. station of despatch

rates offered by the firms are not accepted and

such tenders will be summarily rejected.

10.

The quantities specified in the schedule are only

approximate.

The actual quantity to be delivered

to the destinations will be intimated while placing

supply orders.

11.

Payment will be effected only after giving training

by skilled personels, ascertaining the quality &

working condition of the items supplied, subject to

the availability of funds and priority of supplies.

12.

The security deposit furnished by the firms will be

released only after the warranty period.

13.

The only jurisdiction for any disputes regarding

this purchase will be at Thiruvananthapuram.

14.

All the documents produced by the tenderers

should be attested by a Gazetted officer.

Gaz. No. 8/2009/DTP (Stores).

15.

The Director reserves all rights to delete any item

from the tender without assigning any reason

thereof.

16.

The Director reserves all rights to waive any of the

above mentioned conditions.

17.

If the date scheduled for sale/receipt/opening of

tender is declared as holiday (general/local), the

schedule will be shifted to the next working day

correspondingly.

18.

Advance payment is not possible and, offer of

those tenderers who insist for advance payment

will not be accepted.

19.

Name and place to which the articles are to be

supplied—The District Veterinary Centre, PMG Jn.,

Thiruvananthapuram.

Office of the Director of

Animal Husbandry,

Vikas Bhavan,

(Sd.)

Thiruvananthapuram.

Director.

TENDER NOTICE

[V/2008-09]

No. 961C/2007.

2nd February 2009.

Sealed competitive tenders are invited from

approved manufacturers or authorized distributors/dealers

for supply of the following reagents/items (70 Nos.) for the

use of Molecular Biology Lab, Avian Disease Diagnostic

Laboratory, Thiruvalla as detailed below.

Total Amount—Rs. 3,50,000.

Earnest Money Deposit—1 % of the total quoted

amount.

Cost of tender form :

Original—Rs. 700 + 12.5 % VAT.

Duplicate—Rs. 400 + 12.5 % VAT.

Last date and time of issue of tender form—

24-2-2009, 3 p. m.

Last date and time of receiving tender—

25-2-2009, 4 p. m.

Date and time of opening of tender—

26-2-2009, 11 a. m.

Address of Office from which tender forms are

available and tenders are received—Avain Disease

Diagnostic Laboratory, Manjadi P. O., Thiruvalla, Pin-

689 105, Pathanamthitta (Dist.), Kerala.

All Kerala Government orders and laws applicable to

tenders are applicable to this tender also. Full details of

the above item will be available along with tender forms.

The validity of this tender will be for 6 months from the

date of this tender notification.

Xncp-h√m ]£n-tcmK \n¿Æbime-bn¬ tamfn-°p-e¿

_tbm-fPn et_m-d-´dn D]-tbm-K-Øn-te-°mbn Xmsg ]d-bp∂

dntb-P‚p-Ifpw/hkvXp-°fpw (70 FÆw) hnX-cWw sNøp-hm≥

Xm¬∏-cy-ap≈ \n¿ΩmW ÿm]-\-ßƒ/AwKo-IrX

hnX-c-W-°m¿ F∂nhcn¬ \n∂pw ap{Z-h® Z¿Lm-kp-Iƒ

£Wn-®sIm≈pp-∂p.

AS-¶¬ XpI— 3,50,000 cq].

\nc-X-{Z-hyw— -BsI XpI-bpsS 1%.

Z¿Lmkv t^md-Øns‚ hne :

A ¬— cq] 700 +12.5 % aqey-h¿≤nX \nIpXn.

]I¿∏v—cq] 400 +12.5 % aqey-h¿≤nX \nIpXn.

Z¿Lm-kv t^mdw \¬Ip∂ Ah-km\ Xob-Xnbpw

ka-bhpw—24˛2˛2009, sshIn´v 3 aWn hsc.

Z¿Lm-kv t^mdw kzoIcn°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—25˛2˛2009 sshIn´v 4 aWn hsc.

Z¿Lm-kv Xpd-∂v ]cn-tim-[n-°p∂ Xob-Xnbpw

ka-bhpw—26˛2˛2009 cmhnse 11 aWn.

Z¿Lmkv t^mdw \¬Ip-Ibpw kzoI-cn-°p-Ibpw

sNøp∂ Hm^o-kns‚ hnemkw—]£ntcmK \n¿Æ-b-im-e,

a™mSn ]n. H., Xncp-h-√m, ]Ø-\w-Xn´ Pn√, tIc-fw,

]n≥-˛689 105.

tIcf k¿°m¿ Z¿Lm-kp-Iƒ°v _m-[-I-am-Ip∂ F√m

\nb-a-ßfpw Cu Z¿Lm-kn\pw _m[-I-am-Wv. dntb-P‚p-

IfpsSbp hkvXp-°-fp-sSbpw F√m hnh-c-ßfpw Z¿Lmkv

t^md-Øn-s\m∏w e`y-am-Wv. Cu Z¿Lm-kns‚ Imem-h[n

Cu Z¿Lmkv ]c-ky-s∏-Sp-Ønb XobXn apX¬ 6 amktØ-

°m-bn-cn-°p∂Xm-Wv.

LIST OF ITEMS

Sl.

Name of Reagents/Consumables/

Quantity

No.

Items

(1)

(2)

(3)

Bam HI, 4000 units

1 No.

Eco RI, 5000 units

Hind III, 5000 units

Sal I, 1500 units

Viral RNA isolation Kit (50 isolations)

Blood & Tissue DNA isolation Kit

(50 isolations)

First Strand cDNA Synthesis Kit

(100 reactions)

Proteinase K (1 ml)

3 Nos.

Taq DNA Polymerase (recombinant),

500 units

10 X Taq Buffer with KCI and

15mM MgC12 (5×1 ml set)

10 X Taq Buffers with KCI set (6×1 ml)

1 No.

25mM MgC12 (5×1 ml set)

Ribonuclease A (RNase A),

DNase-free, 10 mg

Nuclease-free water (5×1 ml set)

4 Nos.

dNTP Mix, 10mM (1 ml)

M-MuLV Reverse Transcriptase,

1000 units

1 No.

H Minus M-MuLV Reverse

Transcriptase 10000 units

Oligo (dT) 18 Primer, 120 μl

Random Hexamer Primer, 120 μl

2 Nos.

RNase Inhibitor, 2500 units

100bp DNA Ladder Plus, 50 μlg

1kb DNA Ladder, 5×50 μg

1 No.

6X Loading Dye Solution (5×1 ml set)

2 Nos.

10X TBE Electrophoresis Buffer (1 Litre)

1 No.

2X RNA Loading Dye Solution (1 ml)

DEPC-treated Water (5×1 ml set)

2 Nos.

Ethidium bromide, ready to use 10ml

1 No.

Agarose, Low EEO, 100g

Diethyl Pyrocarbonate, 25g

Boric Acid

(Molecular biology grade), 500g

EDTA (Molecular biology grade), 500g

EDTA 0.5 M Sterile Solution,

RNase-Free, 100ml

Ethanol

(Molecular biology grade), 500ml

3 Nos.

PBS Tablets-100ml, 100 Tablets

1 No.

Phenol: Chloroform (PH 6. 7/8.0) 500ml

Phenol: Chloroform: lsoamyl

alcohol 100ml

Chloroform: Isoamyl alcohol,

24: 1, 500mL

Sodium Acetate,

(Molecular biology grade), 500g

Sodium Bicarbonate A. R., 500g

2 Nos.

Sodium Chloride A. R., 500g

Sodium dodecyl sulphate (SDS), 100g

1 No.

Tris base, 500g.

2 Nos.

TE buffer, (PH 8.0), 100ml

Isopropyl alcohol, 1 litre

Disodium citrate 500g

Phenol-Guanidium Isothiocyanate

Reagent for RNA isolation, 100ml

2 Nos.

Carboy with Spigot, LDPE,

Volume 10 litres.

1 No.

0.2 ml PCR tubes, 1,000 pcs/pack,

transparent with caps

1 Pack

Microcentrifuge tube storage

Boxes. (96 places)

6 Nos.

Microcentrifuge tube storage

Racks. (96 places)

Lab top cooler (for-20ºc storage)

1 No.

Parafilm roll (4"×125")

Nitrile Powder free gloves,

medium size (100 Pcs/Pack)

5 Packs

2.0 ml EPPENDORF tubes 1000Pcs/Pack

1 Pack

1.5 ml microcentrifuge tubes,

1000pcs/Pack

No.

Tag stickers rectangular, 1.28×0.5"

Yellow color, 1000

Roll

Custom Oligonucleotides (Primers) required at an

OD level of 3.0 (50n moles)

IBSIF 5’-GCTCTAGAATGTTGGTAA

1 tube

CACCTCTT-3’

each

IBSIR 5’-GGGATCCTTAATAACTAA

CATAAGGGCA-3’

IBDF 5’-GCATGCGGTATGTGAG

GCTTGGTGAC-3’

IBDR 5’-GAATTCGATCCTGTTG

CCACTCTTTC-3’

MDF 5’-TACTTCCTATATAGA TT

GAGACGT-3’

MDR 5’-GAGATCCTCGTAAGGT

GTAATATA-3’

NDFF 5’-GCAGCTGCAGGGATTGTGGT-3’

NDFR 5’-TCTTTGAGCAGGAGGAT GTTG-3’

DPVF 5’-GAAGGCGGGTATGTAATGTA-3’

DPVR 5’-CAAGGCTCTATTCGGTAATG-3’

MGF:5’—GAGCTAATCTGTAAAGTTGGTC-3’

MGR:5’—GCTTCCTTGCGGTTAGCAAC-3’

BAF 5’—TCCTAACACTAACGAAGTCG-3’

BAR 5’—GAGGTAGAAGGATATACGGT-3’

PMF 5’—TGCCAAAATCGCAGTCAG-3’

PMR5’—TTGCCATCATTGTCAGTG-3’

FMDF 5’—GCCTGGTCTTTCCAGGTCT-3’

FMDR 5’—CCAGTCCCCTTCTCAGATC-3’

SFVF 5’—ATTGGCTCCATGCGGCTAGCCT

GCAAGGAAGATTAC-3’

SFVR 5’—CCCGGGAATTCCATGAA

ACAGCAGTAGTATCCATTTCTT-3’

cIL—2F 5’—ATGATGTGCAAAGTA

CTGATCTTTGGCTGT-3’

cIL—2R 5’—TTATTTTTGCAGATA

TCTCACAAAGTTGGTCA-3’

bIL-2F 5’—GTCAGCAATGTACA

AGATACAACTC-3’

bIL-2R 5’—GAGAGGCACTTAGTGA

TCAAGTCA-3’

Avian Disease Diagnostic

Laboratory, Manjadi,

(Sd.)

Thiruvalla.

Deputy Director.

(1)

(2)

(3)

(1)

(2)

(3)

Health Services Department

TENDER NOTICES

(1)

No. A2-2423/2008/ICHG.

28th January 2009.

Sealed tenders are invited for the supply of Double

Surface Phototherapy Unit-2 Nos. for the use in ICH,

Kottayam. The tenders should be superscribed tender No.

& date and addressed to the Superintendent, Institute of

Child Health, Gandhinagar, Kottayam. Tender form can be

had from the office of the undersigned on all working

days on written request and payment in cash, M.O.

Cheque, Draft etc. will not be accepted.

E. M. D.—1% of quoted value.

Cost of Tender forms :

Original—Rs. 150 +Tax.

Duplicate—Rs. 100 + Tax.

Last date and time of sale of tender forms—

25-2-2009, 3 p. m.

Last date and time for receipt of tender—

26-2-2009, 1 p. m.

Date and time of opening tender—26-12-2009,

2 p. m.

All other Govt. rules regarding tenders are applicable

to this tender also.

tIm´bw

saUn-°¬

tImtfPv

Ip´n-I-fpsS

Bip-]-{Xn-bn-te°v U_nƒ k¿t^kv t^mt´m-sX-dm∏n

bqWn-‰v-˛2 FÆw hmßp-∂-Xn\v ap{ZWw sNbvX

Z¿Lm-kp-Iƒ £Wn-®p-sIm-≈p-∂p. sS≠¿ AS°w sNbvX

Ih-dn\v ]pdØv sS≠¿ \º¿, kzoI-cn-°p∂ XobXn

F∂nh hy‡-ambn tcJ-s∏-Sp-Øn-bn-cn-°-Ww. sS≠¿ t^mdw

kq{]-≠ns‚ B^o-kn¬ \n∂pw Fgp-Xn-s°m-Sp-°p∂

At]-£-bn¬ ]Ww HSp-°n-bm¬ ]I¬ aq∂v aWn-hsc

e`n-°p-∂-Xm-Wv. sN°v, {Um^v‰v, apX-em-bh kzoI-cn-

°p-∂-X-√. sS≠¿ ^md-Øns‚ hne Hcp Imc-W-h-imepw

XncnsI e`n-°p-∂-X-√. sS≠¿ ]q¿Æ-am-tbm, `mKoI-amtbm

ap≥Iq¿

Adn-bn-∏p-Iq-SmsX

\nc-kn-°p-hm≥

kq{]-≠n\v A[n-Im-c-ap-≠v.

sS≥U¿ ka¿∏n-°p-tºmƒ samØw hne-bpsS Hcp

iX-am\w \nc-X-{Z-hy-ambpw 50 cq]-bpsS tIcf

ap{Z]{X-Øn¬ Hcp XmXv°m-enI F{Kn-sa‚ v kq{]-≠ns‚

t]cn¬ ka¿∏n-t°-≠-Xm-Wv.

Z¿Lmkv t^md-Øns‚ hne :

A ¬—cq] 150 + \nIp-Xn.

]I¿∏v—cq] 100 + \nIp-Xn.

Z¿Lmkv t^mdw hn¬°p∂ Ah-km\ XobXnbpw

kabhpw— 25˛2˛2009, 3 aWn.

Z¿Lmkv t^mdw kzoI-cn-°p∂ Ah-km\ XobXnbpw

kabhpw—26˛2˛2009, 1 aWn.

Z¿Lmkv t^mdw Xpd°p∂ XobXnbpw kabhpw—

26˛12˛2009, 2 aWn.

sS≠dns\ kw_-‘n-°p∂ F√m \n_-‘-\-Ifpw Cu

sS≠dn\pw _m[-I-am-Wv.

SPECIFICATION

Light source designed to give an irradiance upto

30 mw/cm2 between 430-490 mm wave length

range at the mattress.

Blue labeled F OT12/20W or TL 52/20W 4

above & 4 below.

Height adjustable-upper one and lower one. Up to

10-15 cm to the baby, upper light source filtable so

as take out baby.

Cooling Fan.

Clear Filter.

Timer

Infant Trolley:

Clear acrylic collapsible side panels.

Acrylic Tray and mattress with Head up/Down

facility.

Lower shelves

Infant care trolley should be detachable.

Mobile stand with height adjustment facility and

easy swiveling of source.

(2)

No. A2-2465/2008/ICHG.

28th January 2009.

Sealed tenders are invited for the supply of

Multichannal Cardiac Analyser for the use in ICH

Kottayam. The tenders should be superscribed tender

No. & date and addressed to the Superintendent,

Institute of Child Health, Gandhinagar, Kottayam. Tender

form can be had from the office of the undersigned on all

working days on written request and payment in cash,

M.O., Cheque, Draft etc. will not be accepted.

E. M. D.—1% of quoted value.

Cost of tender form :

Original— Rs. 150 + Tax.

Duplicate—Rs. 100 + Tax.

Last date and time of sale of tender forms—

25-2-2009, 3 p. m.

Last date and time for receipt of tender —

26-2-2009, 1 p. m.

Date and time of opening tenders—26-2-2009, 2 p. m.

All other Govt. rules regarding tender are applicable

to this tender also.

tIm´bw

saUn-°¬

tImtfPv

Ip´n-I-fpsS

Bip-]-{Xn-bn-te°v aƒ´n Nm\¬ Im¿Un-bmIv A\-sse-k¿

hmßp-∂-Xn\v ap{ZWw sNbvX Z¿Lm-kp-Iƒ £Wn-®p

-sIm-≈p-∂p. sS≥U¿ AS°w sNbvX Ih-dn\v ]pdØv

sS≥U¿ \º¿, kzoI-cn-°p∂ XobXn F∂nh hy‡-ambn

tcJ-s∏-Sp-Øn-bn-cn-°-Ww. sS≥U¿ t^mdw kq{]-≠ns‚

B^o-kn¬ \n∂pw Fgp-Xn-s°m-Sp-°p∂ At]-£-bn¬

]Ww HSp-°n-bm¬ ]I¬ aq∂v aWn-hsc e`n-°p-∂-Xm-Wv.

sN°v, {Um^v‰v apX-em-bh kzoI-cn-°p-∂-X-√. sS≥U¿

t^md-Øns‚ hne Hcp Imc-W-h-imepw Xnc nsI

e`n-°p-∂-X-√. sS≥U¿ ]q¿Æ-am-tbm `mKn-I-amtbm ap≥Iq¿

Adn-bn-∏p-Iq-SmsX

\nc-kn-°p-hm≥

kq{]-≠n\v

A[n-Im-c-ap-≠v.

sS≥U¿ ka¿∏n-°p-tºmƒ samØw hne-bpsS Hcp

iX-am\w \nc-X-{Z-hy-ambpw 50 cq]-bpsS tIcf ap{Z

]{X-Øn¬ Hcp XmXv°m-enI F{Kn-sa‚ v kq{]-≠ns‚

t]cn¬ ka¿∏n-t°-≠-Xm-Wv.

Z¿Lmkv t^md-Øns‚ hne :

A ¬—cq] 150 + \nIp-Xn.

]I¿∏v—cq] 100 + \nIp-Xn.

Z¿Lmkv t^mdw hn¬°p∂ Ah-km\ XobXnbpw

kabhpw—25˛2˛2009, 3 aWn.

Z¿Lmkv kzoI-cn-°p∂ Ah-km\ XobXnbpw

kabhpw—26˛2˛2009, 1 aWn.

Z¿Lmkv Xpd°p∂ XobXnbpw kabhpw—26˛2˛2009,

2 aWn.

D]-I-c-WsØ kw_-‘n® IqSp-X¬ hnh-c-ßƒ

kq{]-≠ns‚ Hm^o-kn¬ \n∂pw Adn-bm-hp-∂-Xm-Wv.

sS≥U-dns\ kw_-‘n-°p∂ F√m \n_-‘-\-Ifpw

Cu sS≥U-dn\pw _m[-I-am-Wv.

SPECIFICATION

Automated 6 channel recording and 3+R LCD

Monitor.

Defibrillation protection.

Automated ECG Interpretation programme.

Lait ECG recording memory.

Thermal print out.

(3)

No. A2-133/2009/ICHG.

30th January 2009.

Sealed tenders are invited for the supply of

Measured Volume Set-2000 Nos. for the use in ICH,

Kottayam. The tenders should be superscribed tender

No. & Date and addressed to the Superintendent,

Institute of Child Health, Gandhinagar, Kottayam. Tender

form can be had from the office of the undersigned on all

working days on written request and payment in cash,

M.O., Cheque, Draft etc. will not be accepted.

Cost of tender forms:

Original— Rs. 150 + Tax.

Duplicate—Rs. 100 + Tax.

Last date and time of sale of tender forms—

2-3-2009, 3 p. m.

Last date and time for receipt of tender—

3-3-2009, 1 p. m.

Date and time of opening of tender—3-3-2009,

2 p. m.

All other Govt. rules regarding tender are applicable

to this tender also.

tIm´bw

saUn-°¬

tImtfPv

Ip´n-I-fpsS

Bip-]-{Xn-bn-te°v satj¿Uv thmfnbw sk‰v˛2000 FÆw

hmßp-∂-Xn\v ap{ZWw sNbvX Z¿Lm-kp-Iƒ £Wn-®p-

sIm-≈p-∂p. sS≥U¿ AS°w sNbvX Ih-dn\v ]pdØv

sS≥U¿ \º¿, kzoI-cn-°p∂ XobXn F∂nh hy‡-ambn

tcJ-s∏-Sp-Ønbn-cn-°-Ww. sS≥U¿ t^mdw kq{]-≠ns‚

B^o-kn¬ \n∂pw Fgp-Xn-s°m-Sp-°p∂ At]-£-bn¬

]Ww HSp-°n-bm¬ ]I¬ aq∂v aWn-hsc e`n-°p-∂-Xm-Wv.

sN°v, {Um^v‰v, apX-em-bh kzoI-cn-°p-∂-X-√. sS≠¿

t^md-Øns‚ hne Hcp Imc-W-h-imepw XncnsI e`n-°p-∂-

X-√. sS≥U¿ ]q¿Æ-am-tbm `mKn-I-amtbm ap≥Iq¿

Adn-bn-∏p-Iq-SmsX \nc-kn-°p-hm≥ kq{]-≠n\v A[n-Im-c-ap-≠v.

sS≥U¿ ka¿∏n-°p-tºmƒ samØw hne-bpsS Hcp

iX-am\w \nc-X-{Z-hy-ambpw 50 cq]-bpsS tIcf ap{Z

]{X-Øn¬ Hcp XmXv°m-enI F{Kn-sa‚ v kq{]-≠ns‚

t]cn¬ ka¿∏n-t°-≠-Xm-Wv.

sS≥U¿ t^mdw A -en\v 150 cq]bpw \nIp-Xnbpw

]I¿∏n\v 100 cq]bpw \nIp-Xnbpw HSp-t°-≠-Xm-Wv.

Z¿Lmkv t^mdw hn¬°p∂ Ah-km\ XobXnbpw

kabhpw—2˛3˛2009, 3 aWn.

Z¿Lmkv kzoI-cn-°p∂ Ah-km\ XobXnbpw

kabhpw—3˛3˛2009, 1 aWn.

Z¿Lmkv Xpd°p∂ XobXnbpw kabhpw—3˛3˛2009,

2 aWn.

D]-I-c-WsØ kw_-‘n® IqSp-X¬ hnh-c-ßƒ

kq{]-≠ns‚ Hm^o-kn¬ \n∂pw Adn-bm-hp-∂-Xm-Wv.

sS≠dns\ kw_-‘n-°p∂ F√m \n_-‘-\-Ifpw Cu

sS≠-dn\pw _m[-am-Wv.

Institute of Child Health and

Children’s Hospital,

(Sd.)

Gandhi Nagar, Kottayam.

Superintendent.

TENDER NOTICES

(1)

No. S/4558/2008.

15th January 2009.

Sealed tenders are invited from Manufacturers/

Authorised dealers/Agencies for the supply of following

items to Government Mental Health Centre, Kozhikode.

Gaz. No. 8/2009/DTP (Stores).

Sl.

Name of

Quantity

No.

Item

Nos.

Refrigerator with stabilizer 165 Ltr.

Electrical Stabilizer instrument

High pressure water jet 80 Psi

1 phase 250 volt

Open inpeller pump 2 HP 1 PH

with 2.5 mm cable need with

DOL starter

Water purifier 250V operating

voltage

Water filter

B.P. Apparatus

Stethoscope

Flame Photometre

Electric Heater-Hote Plate 2 Kw

Hemoglobin Meter

Shambles pitted leach

Psychological Testing

Different

material

test material

E.M.D.—1% of total cost of tendered items.

Cost of tender form :

Original—Rs. 400 + 12.5% VAT.

Duplicate—Rs. 200 + 12.5% VAT.

Last date and time for sale of tender form—

24-2-2009 at 3 p. m.

Date and time for receipt of tender—25-2-2009,

4 p. m.

Date and time for opening of tender—26-2-2009 at

11 a. m.

The envelops containing tender should be addressed

to the Superintendent, Government Mental Health Centre,

Kozhikode-16. Tender No. and date should be subscribed

on the tender.

Cheque or Bond, DD towards the cost of tender form

will not be accepted.

Specification and other details

regarding the tender will be available from the office

during working hours.

Tender should be accompanied

by an agreement executed in Kerala Stamp Paper worth

Rs. 50. The specimen of agreement is available in the last

page of tender form.

The undersigned reserves the right to postpone or

cancel the tender without assigning any reason

whatsoever.

tImgnt°mSv Kh¨sa‚ v am\knI BtcmKy

tI{μØn¬ Xmsg sImSpØncn°p∂ D]IcWßƒ

hnXcWw sNøp∂Xn\v DXv]mZI/AwKoIrX hnXcW°m¿/

GP≥knIƒ F∂nhcn¬ \n∂pw ap{Zh® sS≠dpIƒ

£Wn®psIm≈p∂p.

{Ia

hnXcWw

\º¿

sNtø≠Xmb

FÆw

km[\ßƒ

d{^nPtd‰¿ 165 en‰¿

sÃ_nssektdmSpIqSn

CeIv{Sn°¬ sÃ_nssek¿

C≥kv{Spsa‚ v

ssl {]j¿ hm´¿sP‰v 80

]n. Fkv. sF. 1 t^kv 250 hm´v

Hm∏¨ Cwss]e¿ ]ºv 2

F®v]n 1 ]n. F®v. 2.5 Fw.Fw.

tI_nƒ do¬ Un. H.F¬. Ãm¿´¿ AS°w

hm´¿ ]yqcn^b¿ 1250 hmƒ´v

thmƒt´Pv bp. hn. AS°w

hm´¿ ^n¬‰¿

_n. ]n. A∏mc‰kv

sÃXkvtIm∏v

^vsfbnw t^mt´m ao‰¿

CeIv{SnIv lo‰¿/tlm´v ]vsfbv‰v 2 sI. hn.

lotamKvtfm_n≥ ao‰¿

jmw]nƒkv ]n‰Uv eo°v

sskt°mtfmPn°¬

hnhn[Xcw

sSÃnwKv sa‰ocnb¬

a\:imkv{X

sSÃpIƒ

sNøphm\p≈

D]IcWßƒ.

\ncX{Zhyw—sS≠dn¬ ImWn®ncn°p∂ samØw

XpIbpsS 1%.

sS≠¿ t^md-Øns‚ hne :

Hdn-Pn-\¬—cq] 400 + hm‰v 12.5%.

Uyqπn-t°‰v —cq] 200 + hm‰v 12.5%.

sS≠¿ t^mdw hn¬°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—24˛2˛2009 sshIpt∂cw 3 aWn.

sS≠dpIƒ Hm^okn¬ kzoI-cn-°p∂ Xob-Xnbpw

ka-bhpw—25˛2˛2009 sshIpt∂cw 4 aWnhsc.

sS≠¿

Xpd-°p∂

Xob-Xnbpw

ka-bhpw—

26˛2˛2009 cmhnse 11.30 aWn.

sS≠¿ ASßnb Ihdn≥ta¬ sS≥U¿ \º¿, XobXn

F∂nh FgpXn kq{]≠v, Kh¨sa‚ v am\knI BtcmKy

tI{μw,

tImgnt°mSv ˛16

F∂

hnemkØn¬

Abbvt°≠XmWv.

sS≠¿ t^mdØn‚ hnebmbn sN°v, _m¶v Un. Un. Iƒ

F∂nh kzoIcn°p∂X√. sS≠¿ sNøp∂ km[\ßsf

kw_‘n®pw a‰pap≈ hnhcßƒ {]hrØn Znhkßfn¬

B^okn¬ \n∂pw e`yamWv. \ncX{Zhyw tZikm¬IrX

_m¶n¬ \n∂pw e`n® Unam‚ v {Um^v‰mbn \¬tI≠Xpw

50 cq]bpsS tIcf ap{Z∏{XØn¬ Hcp {]mYanI F{Knsa‚pw

sS≠dns‚ IqsS ka¿∏nt°≠XmWv. F{Knsa‚ns‚

]I¿∏v sS≠¿ t^mdØns‚ Ahkm\ t]Pn¬ e`yamWv.

\ncX{Zhyw, {]mYanI F{Knsa‚ v F∂nh AS°w sNømØ

sS≠dpIƒ kzoIcn°p∂X√.

sS≠dpIƒ 26˛2˛2009˛\v cmhnse 11.30˛\v lmPcmb

sS≠dpImcpsS

km∂n≤yØn¬

kq{]t≠m

a‰v

A[nImcs∏SpØnb DtZymKÿtcm Xpd°p∂XmWv.

sS≠dpIƒ

ImcWw

ap≥Iq´n

ImWn°msX

\o´nhbv°phm\pw d±v sNøphm\pap≈ A[nImcw

kq{]≠n¬ \n£n]vXambncn°pw.

(2)

No. S/4559/2008.

14th January 2009.

Sealed tenders are invited from Manufacturers/

Authorized dealers/Agencies for the supply of following

items to Government Mental Health Centre, Kozhikode.

Sl.

Name of Item with

Quantity

No.

Specification

Required

Copper vessels with lid 40 kg. 50cm dia,

70cm Height

Copper vessels with lid 65 kg, 39” dia,

30” Height

Copper vessels with lid 60 kg, 29” dia,

24” Height

Aluminium vessels/hindalium 29” dia,

16” Height

Knife iron hard

Chirava

Korika large iron 11” dia 38” handle

Iron chattukam 68” length

Aluminium bucket with Lid 22 ltr.

Aluminium bucket with Lid 10 ltr.

Aluminium bucket with Lid 5 ltr.

Stainless Steel bucket 15 ltr.

Stainless Steel bucket 10 ltr.

Steel thavi big

Plastic bucket 20 ltr.

Plastic mug

Plastic bucket for waste

Aluminium bucket 10 ltr.

Steel plate with round edge

425

Steel tumbler with round edge

125

Tiffin carrier big size

Plastic mats 3 meters

235

Plastic mats (Rubber) 3 meters

Rexin sheets —meters

File tray—plastic

Rubber sheets —meters

Plastic hat

Nail cutter

Plastic comb

110

30.

File board

E.M.D.—1% of total cost by D. D.

Cost of tender form :

Original—Rs. 400 + 12.5% VAT.

Duplicate—Rs. 200 + 12.5% VAT.

Last date and time for sale of tender form—

24-2-2009 at 3 p. m.

Date and time for receipt of filled tender form—

25-2-2009, 4 p. m.

Date and time for opening of tender—26-2-2009 at

11 a. m.

The envelops containing tender should be addressed

to the Superintendent, Government Mental Health Centre,

Kozhikode-16.

Late and incomplete tenders will not be accepted.

Tenders will be opened in the presence of tenderers or

their authorized representatives who are present.

Application for tender form should be accompanied

by cash remittance which will not be refunded under any

circumstances. Cheque or Bank Draft will not be accepted

towards the cost of tender form.

Specification and other details of each item will be

available from office during office hours. Tender should

be accompanied by a preliminary agreement executed in

Kerala Stamp Paper worth Rs. 50. The form of agreement

is available in the last page of tender form.

tImgnt°mSv Kh¨sa‚ v am\knI BtcmKy

tI{μØn¬ Xmsg sImSpØncn°p∂ ]m{Xßfpw

D]IcWßfpw hnXcWw sNøp∂Xn\v DXv]mZI/AwKoIrX

hnXcW°m¿/GP≥knIƒ F∂nhcn¬ \n∂pw ap{Zh®

sS≠dpIƒ £Wn®psIm≈p∂p.

{Ia

hnXcWw

Afhv/

\º¿

sNtø≠Xmb

FÆw

km[\ßƒ

(1)

(2)

(3)

sNºv aqSnbS°w 40 Intem{Kmw Xq°w,

50 sk. ao. hymkw, 70 sk.ao. Dbcw

sNºv aqSnbS°w 65 Intem{Kmw Xq°w,

39 C©v hymkw, 30 C©v Dbcw

sNºv aqSnbS°w 60 Intem{Kmw Xq°w,

29 C©v hymkw, 24 C©v Dbcw

Aeqan\nbw/ln‚menbw ]m{Xw 29 C©v

hymkw, 16 C©v Dbcw

Ccpºv IØn

Nnch

Ccpºv tImcnI (hepXv) 11 C©v hymkw,

38 C©v ]nSn \ofw

Ccpºv N´pIw 68 C©v \ofw

Aeqan\nbw _°‰v aqSnbS°w 22 en‰¿

Aeqan\nbw _°‰v aqSnbS°w 10 en‰¿

Aeqan\nbw _°‰v aqSnbS°w 5 en‰¿

sÃbn≥sekv Ão¬ _°‰v 15 en‰¿

sÃbn≥sekv Ão¬ _°‰v 10 en‰¿

Ão¬ Xhn (hepXv)

πmÃnIv _°‰v 20 en‰¿

πmÃnIv aKv

πmÃnIv _°‰v (thÃv _°‰v)

Aeqan\nbw _°‰v 10 en‰¿

Ão¬ sπbn‰v (h°v Dcp≠Xv)

425

Ão¬ Sw_vf¿ (h°v Dcp≠Xv)

125

Sn^n≥ Imcnb¿ (hepXv)

πmÃnIv am‰v 3 ao‰¿

235

πmÃnIv am‰v (d∫¿) 3 ao‰¿

dIvkn≥ jo‰v—ao‰¿

^b¬ s{S—πmÃnIv

d∫¿ jo‰v—ao‰¿

πmÃnIv lm‰v

s\bn¬ I´¿

πmÃnIv No¿∏v

110

^b¬ t_m¿Uv

\ncX{Zhyw—samØw sS≠¿ XpIbpsS 1%.

sS≠¿ t^md-Øns‚ hne :

Hdn-Pn-\¬—cq] 400 + 12.5 % hm‰v.

Uyqπn-t°‰v —cq] 200 + 12.5% hm‰v.

sS≠¿ t^mdw hn¬°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—24˛2˛2009, sshIpt∂cw 3 aWn.

]qcn∏n® sS≠¿ t^mdw Hm^okn¬ kzoI-cn-°p∂

Ahkm\ Xob-Xnbpw ka-bhpw—25˛2˛2009 sshIpt∂cw 4

aWnhsc.

sS≠¿

Xpd-°p∂

Xob-Xnbpw

ka-bhpw—

26˛2˛2009, cmhnse 11 aWn.

sshIn

In´p∂Xpw

A]q¿Æhpamb

sS≠¿

kzoIcn°p∂X√. lmPcm°p∂ sS≠dpIƒ B^okn¬

h®v kq{]t≠m, A[nImcs∏SpØnb a‰v DtZymKÿtcm

sS≠¿

Xpd°p∂Xmbncn°pw.

sS≠dpIƒ

\o´nhbv°p∂Xn\pw d±v sNøp∂Xn\pap≈ A[nImcw

kq{]≠n¬ \n£n]vXambncn°pw.

sS≠dnt\msSm∏w 50 cq]bpsS ap{Z]{XØn¬

Xømdm°nb {]mYanI DSºSn AS°w sNtø≠XmWv.

\ncX{Zhyhpw {]mYanI DSºSnbpw C√mØ sS≠dpIƒ

\nckn°p∂Xmbncn°pw.

IqSpX¬ hnhcßƒ {]h¿Øn Znhkßfn¬ B^okn¬

\n∂pw e`yamWv.

Govt. Mental Health Centre,

(Sd.)

Kozhikode.

Superintendent.

TENDER NOTICE

No. S3/6978/08/IMCH.

31st January 2009.

Sealed and competitive tenders are invited for the

purchase of Oxygen Flow meter with regulator and

Humidifying bottle ISI standard–59 Nos. for the use of this

institution. The cover containing tenders should be

superscribed with tender numbers as indicated in the

statements below and should be addressed to the

Superintendent, Institute of Maternal and Child Health,

Medical College P.O., Calicut-8, Kerala. Tender will be

opened at 11 a.m. on 28-2-2009 in the presence of such of

the tenderers or their authorized persons who may be

present at that time. Belated tenders will not be accepted.

(1)

(2)

(3)

(1)

(2)

(3)

Indending tenderers may on application to the

Superintendent, IMCH, Medical College, Calicut, Kerala will

obtain the requisite tender form in which the tenders to be

submitted. Application for tender forms should be

accompanied by cash remittance as noted below for a set

of tender forms, which will not be refunded under any

circumstances. The tender forms are not transferable.

Postage stamp, Draft, etc. will not be acceped towards the

cost of tender forms. Tender forms will not be sent by

VPP. Money order will be accepted. If tender forms are to

be sent by post, Rs. 50 should be paid additionally

towards the postage coverage. Tender should be

accompanied by EMD amounting to 1% (Rounded to

nearest to 1 Rupee) of the total cost of articles tendered

for. The tenderers should produce samples of the items,

Brand name and Brochures. The tenders do not

accompanied by sufficient EMD will not be entertained.

The indenting tenderers should also ready for

demonstration.

Tender No.— S3/6978/08/IMCH.

Cost of tender forms (Including Tax):

Original—Rs. 450.

Duplicate—Rs. 225.

Postage charge if any—Rs. 50 (Additional)

Closing date and time

of sale of tender—

26-2-2009, 3 p. m.

Last date and time of receipt of tender—27-2-2009,

5 p. m.

Opening date and time of tender—28-2-2009,

11 a. m.

Date upto which the rates are to be firm—

31-12-2009.

Further details can be had from the office of the

undersigned during the office hours on any working day.

The undersigned has the right to postpone/cancel the

tender process without prior notice and decision taken by

the Superintendent will be final.

-tImgn-t°mSv saUn°¬ tImtfPv sF. Fw. kn.- F-®v.

Bip-]-{Xn-bn-te°v HmIvkn-P≥ ^vtfmao-‰¿ hnØv

dKp-te-‰¿ B‚ v lpan-Un-ss^-bnßv t_m´n-ep-Iƒ-˛sF. Fkv.

sF. Ãm≥t‚-¿Uv˛59 FÆw hnX-cWw sNøp-∂-Xn\v \n›nX

t^mdØn-ep≈ ap{Z-h® Z¿Lm-kp-Iƒ £Wn-®p-sIm-≈p-∂p.

Z¿Lm-kp-Iƒ AS°w sNbvXn-´p≈ Ih-dn-\p-ap-I-fn¬ Z¿Lmkv

\º¿ FgpXn kq{]≠,v C≥Ãn-‰yq´v Hm^v sat‰¿W¬

B‚ v ssN¬Uv sl¬Øv, tImgn-t°mSv˛8, tIcfw F∂

hnem-k-Øn¬ Abbv-t°-≠-Xm-Wv. Z¿Lm-kp-Iƒ Xmsg

tN¿Øn-´p≈ Xob-Xn-bnepw ka-bØpw At∏mƒ lmP-

cmbn´p≈

Z¿Lmkv

ka¿∏n-®-h-cp-sStbm

Ah¿

Npa-X-e-s∏-Sp-Øn-bn-´p≈ GP‚pamcp-sStbm km∂n-≤y-Øn¬

28-˛2-˛2009 cmhnse 11 aWn°v Xpd-°p-∂-Xm-Wv.

sshIn-°n-´p∂ Z¿Lm-kp-Iƒ ]cn-K-Wn-°p-∂-X√. Z¿Lm-kp-

Iƒ ka¿∏n-°phm≥ B{K-ln-°p-∂h¿ Cu Hm^o-kn¬

At]-£n-°p-∂-]£w Bh-iy-amb Z¿Lmkv t^md-ßƒ

Xmsg sImSp-Øn-cn-°p∂ {]Imcw XpI AS-®m¬

e`n-°p-∂-Xm-Wv. Z¿Lmkv t^md-ßƒ ssIam‰w sNøp-

hm≥]mSp-≈-X-√. sN°p-Iƒ t]mtÃPv Ãmºp-Iƒ,

{Um^v‰p-Iƒ F∂nh Z¿Lmkv t^md-Øns‚ hne-bmbn

kzoI-cn-°p-∂-X-√. t^md-ßƒ hn.-]n.-]n. Bbn Ab-°p-∂

-X-√. sS≠¿ t^mdw X]m-en¬ Bh-iy-ap-≈-h¿ X]m¬

Nm¿÷mbn 50 cq] IqSp-X¬ AS-bvt°-≠-Xm-Wv.

sS≠¿ ka¿∏n-°p-∂-h¿ hnX-cWw sNøp∂ km[-\-

Øns‚ LS-\bpw a‰p hnh-c-ßfpw AS-ßnb t{_mj¿

AS°w sNbvXn-cn-°Ww. As√¶n¬ amXrI AS-bm-f-

s∏-SpØn AS°w sNbvXn-cn-°Ww. sS≠¿ ka¿∏n-°p-∂-h¿

Bh-iy-s∏-´m¬ hnX-cWw sNøp∂ km[-\-Øns‚ kmºnƒ

KpW-\n-e-hmc ]cn-tim-[-\bv°v lmP-cm-t°-≠-Xm-Wv.

sSIv\n-°¬ IΩn-‰n-bpsS AwKo-Im-c-Øn-\p-tijw

Xnc-s™-Sp-°-s∏-Sp∂ ÿm]\w km[-\-Øns‚ Hcp

kmºnƒ ka¿∏n-t°-≠-Xm-Wv. km[-\-Øn\v Kymc≠n

\¬tI-≠-Xm-Wv. \nc-X-{Z-hy-ambn sS≠-dn¬ ImWn-°p∂

samØ-hn-e-bpsS Hcp iX-am\w kwJy-bv°p≈ _m¶v

{Um^v‰v kq{]-≠ns‚ t]cn-se-SpØv AS°w sNbvXn-cn-

°-Ww. A√mØ sS≠-dp-Iƒ \nc-kn-°p-∂-Xm-Wv.

sS≠¿ \º¿—Fkv3˛6978/08/sF.-Fw.-kn.-F-®v.

Z¿Lmkv t^md-Øns‚ hne (\n-Ip-Xn-b-S-°w)—

A ¬—450 cq].

]I¿∏v—225 cq].

X]m-en¬ e`n-°p∂-Xn\v—50 cq] (A-[n-Iw)

Z¿Lmkv t^mdw hn¬°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—26-˛2˛2009 sshIp-t∂cw 3 aWn.

Z¿Lmkv t^mdw kzoIcn°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—27-˛2˛2009 sshIp-t∂cw 5 aWn.

Z¿Lmkv Xpd°p∂ Xob-Xnbpw ka-bhpw—28-˛2-˛2009,

cmhnse 11 aWn.

\nc-°p-Iƒ {]m_-ey-Øn-en-cn-t°≠ XobXn—31-˛12-˛2009.

IqSp-X¬ hnh-c-ßƒ {]hrØn ka-bØv Cu

Hm^okn¬ t\cn´v At\z-jn-®-dn-bm-hp-∂-Xm-Wv. sS-≠¿

\S-]-Sn-Iƒ ap∂-dn-bn-∏n-√msX \o´n-h-bv°mt\m, \n¿Øn

-h-bv°mt\m D≈ A[n-Imcw kq{]-≠n¬ \n£n-]vX-am-Wv.

Institute of Maternal and

(Sd.)

Child Health, Kozhikode.

Superintendent.

RE-TENDER NOTICE

No. B2-14512/2008.

31st January 2009.

Sealed competitive and superscribed tenders are

invited from reputed manufacturers/dealers to supply

Spare Parts to the various Hospitals attached to the

District Medical Office of Health, Kannur for

the year 2008-09.

Tenders should be superscribed “Tenders for the

supply of Spare Parts for the repair for Hospital

Equipments of Kannur District for the year 2008-09” and

addressed to the District Medical Officer of Health,

Kannur, Civil Station P. O., Kannur-670 002. Tender should

quote for all the items (Name of spare parts) shall be

quoted including comprehensive AMC for 5 years.

Intending tenderers may an application to the

District Medical Officer (Health), Kannur obtain the

requisite tender forms against cash remittance, in which

the tender to be submitted, Cheques, Postal Orders,

Demand Draft etc. will not be accepted towards the cost

of tender forms and the tender forms will not be sent by

V. P. P.

List of Spareparts and conditions of tenders will be

had from the office along with tender forms.

Probable Amount of Cost—Rs. 98,865

Cost of tender form :

Original—Rs. 700 + 12.5% VAT.

Duplicate—Rs. 350 + 12.5% VAT.

Date and time for sale of tender forms—20-2-2009 to

26-2-2009, 3 p. m.

Last date and time for receipt of tender forms—

28-2-2009, 12 Noon.

Date and time of opening of tender forms—28-2-2009,

at 3 p. m.

Date upto to which the rates are to be remain firm

for acceptance—31-3-2009.

Period of supply—within 15 days of receipts of

supply order.

GENERAL CONDITIONS

Tender forms are neither transferable nor the cost

refundable.

A preliminary agreement in the format given in the

tender form is to be executed in Kerala Stamp Paper

of value of Rs. 50 by the successful tenderer.

An EMD at 1% of the cost of items tendered for

shall accompany the tenderer by Demand Draft

drawn in favour of District Medical Officer (Health),

Kannur subject to the minimum of Rs. 1,000. The

firms who are exempted for furnishing EMD should

enclose the attested copy of the exemption order.

EMD will not carry any interest.

Rates and sales tax and condition of supply of

articles should be clearly stated in respect of each

item.

Articles should be supplied within 15 days of the

receipt of supply order at their own cost at District

Medical Officer (Health), Kannur.

Tenders will be opened in the presence of such of

the tenderers or their authorized representatives who

may be present at the time of opening of tender.

Due to any reason if the day of opening the tender

is declared as a public holiday, the same will be

opened on the next working day.

Gaz. No. 8/2009/DTP (Stores).

The District Medical Officer (Health), Kannur and

the purchasing committee possess the right to

accept or reject any tender without assigning any

reason thereof.

Successful tenderer should furnish 5% of total cost

as security deposit.

10.

All the conditions applicable to Government tender

will be applicable in this case also.

Further details if any can be had from the office of

the undersigned during working hours.

IÆq¿ Pn√m saUn-°¬ B^o-kns‚ Iogn¬

{]h¿Øn-°p∂ hnhn[ Bip-]-{Xn-I-fnse Bip-]{Xn

D]-I-c-W-ßƒ dn∏-b¿ sNbvXv D]-tbm-K-tbm-Ky-am-°p-∂-Xn\v

th≠n ]´n-I-bn¬ ImWn-®n-cn-°p∂ kvs]b¿ ]mSvkp-Iƒ

hnX-cWw sNøp-∂-Xn\v ap{Z-h® Z¿Lm-kp-Iƒ £Wn-®p

-sIm-≈p-∂p. Z¿Lm-kp-Iƒ Ab-°p∂ Ih-dn\p apI-fn¬

""Pn√m saUn-°¬ B^okv IÆq-¿˛s‚ Iogn-ep≈ hnhn[

Bip-]-{Xn-I-fn-te°v D]-I-c-W-ßƒ dn∏-b¿ sNøp-∂-Xn\v

Bh-iy-amb kvs]b¿ ]mSvkp-Iƒ hnX-cWw sNøp-∂-Xn-

\p≈ Z¿Lmkv'' F∂v Bte-J\w sNtø-≠Xpw Pn√m

saUn-°¬ B^o-k¿ (B-tcm-Kyw), knhn¬ tÃj≥ ]n. H.,

IÆq¿ F∂ t]cn¬ Ab-t°-≠-Xpam-Wv.

Dt±i AS¶¬ XpI—cq] 98,865.

Z¿Lmkv t^md-Øns‚ hne :

A ¬—cq] 700 + 12.5% hm‰v.

]I¿∏v—cq] 350 + 12.5% hm‰v.

Z¿Lmkv t^mdßƒ hn¬°p∂ -Xo-b-Xnbpw

kabhpw—20˛2˛2009 apX¬ 26-˛2-˛2009, 3 aWn hsc.

Z¿Lmkv t^mdßƒ kzoI-cn-°p∂ Ah-km\

-Xo-b-Xnbpw kabhpw—28˛2˛2009, 12 aWn hsc.

Z¿Lmkv Xpd-°p∂ -Xo-b-Xnbpw kabhpw—28˛2˛2009,

3 aWn hsc.

\nc°v \ne-hn-ep-≠m-tI≠ XobXn—31˛3˛2009.

km[\w hnX-cWw sNtø≠ Ime-b-fhv—hnX-cW

Adn-bn∏v e`n®v 15 Znh-k-Øn-\-Iw.

Z¿Lmkv t^mdw e`n-°p-∂-Xn\v apI-fn¬ ]d™

hnem-k-Øn¬ scm°w ]Ww AS®v At]-£n-t°-≠Xpw

{]kvXpX t^md-Øn¬ am{Xw Z¿L-mkp-Iƒ ka¿∏n-t°-≠-

Xp-am-Ip-∂p. Z¿Lmkv t^md-Øns‚ hne-bmbn sN°p-Iƒ,

{Um^v‰p-Iƒ, t]mÃ¬ Hm¿U-dp-Iƒ F∂nh kzoI-cn-°p-

Itbm hn. -]n.- ]n.-bmbn Ab-®p-X-cn-Itbm sNøp-∂-X-√.

s]mXp \n_-‘-\-Iƒ

Z¿Lmkv t^mdw ssIam‰w sNøm≥ ]mSp-≈-X-√.

hnP-b-{]-Z-amb Z¿Lm-kp-Iƒ 50 cq]-bpsS ap{Z-]-{X-

Øn¬ sS≠¿ t^md-Øn¬ ]d™ {]Im-c-ap≈

kΩ-X-]-{Xhpw H∏n-´p-X-tc-≠-Xm-Wv.

Z¿Lm-kv XpI-bpsS 1% C.-Fw.-Un. C\-Øn¬ Pn√m

saUn-°¬ B^o-k¿ (B-tcm-Kyw), IÆq-cns‚ t]cn¬

amdm-hp∂ Un. Un. cq]-Øn¬ ka¿∏n-t°-≠-Xm-Wv.

Npcp-ßnb C.-Fw.-Un. 1000 cq]. C. Fw. Un.

\¬Ip∂-Xn¬ \n∂v Hgn-hm-°-s∏´ ÿm]\-ßƒ

{]kvXpX DØ-c-hns‚ ]I¿∏v ka¿∏n-t°-≠-Xm-Wv.

C.-Fw.-Un. XpIbv°v ]eni e`n-°p-∂-X-√.

Hmtcm-bn-\-Øn-s‚bpw hn¬]\ \nIp-Xn, hnX-cWw

sNøp-∂-Xn-\p≈ \n_-‘-\-Iƒ F∂nh hy‡-ambpw

tcJ-s∏-Sp-tØ-≠-Xm-Wv.

k]vssf Hm¿U¿ e`n®v 15 Znh-k-Øn-\Iw D]-I-c-W-ßƒ

Pn√m saUn-°¬ B^o-kn¬ kz¥w sNe-hn¬

k]vssf sNtø-≠-Xm-Wv.

Z¿Lm-kp-Iƒ ka¿∏n-®-h-cp-sStbm Ah-cpsS {]Xn-\n-[n-

I-fp-sStbm km∂n-≤y-Øn¬ (D-s≠-¶n¬ am{Xw)

{]Jym-]nX Xob-Xn°v Xpd∂v ]cn-tim-[n-t°-≠-Xm-Wv.

Z¿Lm-kp-Iƒ Xpd-°m≥ Xocp-am-\n® Znhkw s]mXp

Hgnhv {]Jym-]n-°-s∏-´m¬ sXm´-SpØ Znhkw

Z¿Lm-kp-Iƒ Xpd-°p-∂-Xm-Wv.

Z¿Lm-kp-Iƒ bmsXmcp Imc-Whpw ImWn-°msX

kzoI-cn-°m\pw \nc-kn-°m\pw D≈ A[n-Imcw Pn√m

saUn-°¬ B^o-k-dnepw ]¿t®knwKv IΩn-‰n-bnepw

\n£n-]vX-am-Wv.

hnP-bn-bmb Z¿Lm-kp-Im-c≥ samØ XpI-bpsS 5%

skIyq-cn‰n sUt∏m-kn-‰mbn \¬tI-≠-Xm-Wv.

10.

k¿°m¿ Z¿Lm-kp-Iƒ°mbn \ne-hn-ep≈ F√m

\n_-‘-\-Ifpw Cu Z¿Lm-kn\pw _m[-I-am-Wv.

hniZ hnh-c-ßƒ°v {]hrØn Znh-k-ß-fn¬ Cu

Hm^o-kp-ambn _‘-s∏-Sp-I.

LIST OF SPARE PARTS

Sl.

Name of Parts

Quantity

No.

Autoclave

Coil-9000 Watts

6 Nos.

Coil-2000 Watts

Coil-1500 Watts B. P. Apparatus

Bulb with Valve

Bladder

Mercury

Kg.

Connector

Nos.

Cuff

Glass tube Sterilizer

Thermostat Switch Refrigerator

Auto-defrost thermostat switch

Thermostat Switch Ordinary

Compressor Kelvinator 1/6

Compressor Godrej 1/6

District Medical Office,

(Sd.)

Kannur.

District Medical Officer (H).

]p\¿ Z¿Lm-kv ]ckyw

\º¿ kn. 379/08.

2009 P\p-hcn 28.

hS-°mt©cn Xmeq-°m-ip-]-{Xn-bn-te°v Bh-iy-amb

Xmsg ]d-bp∂ C\-ßƒ hnX-cWw sNøp-∂-Xn\v Xm¬]-cy-

ap-≈-h-cn¬ \n∂v koep-h® Z¿Lm-kp-Iƒ Xmsg ]d-bp∂

\n_-‘-\-Iƒ°v hnt[-b-ambn £Wn-®p-sIm-≈p-∂p.

{Ia

aXn-∏phne

\º¿

C\w

Afhv

(cq])

F¬. kn. Un. s{]mP-IvS¿

1 FÆw

15,000

Aƒ{Smtkm-Wn°v kvsIbn-e¿

25,000

hnØv Sn]vkv ]ntkm kvsIbn-e¿

sse‰v Iyq¿ bqWn‰v B‚ v

1,3

20,000

^n√nKv sa‰o-cn-b¬

t_mIvkv

tIm∏¿ Aam¬Kw ]uU¿

500

(1 FÆw)

Kvfmkv sFt\m-a¿ ^yqPn

2 FÆw

2,000

_nKvssS∏v- I

(1 FÆw)

Kvfmkv sFt\m-a¿ ^yqPn

1,600

_nKvssS∏v- II

(1 FÆw)

AIzm-Km¿Uv t^m¿

8,000

]yqcn-ss^Uv hm´¿ B‚ vPKv

sSen-hn-j≥ 21 ^vfm‰v (I-f¿)

10,000

hmIzw ¢o\¿

10,000

10.

Bt´m-t¢hv

5,000

11.

shbn-‰nwKv sNb¿

30,000

(3 Ccpºv Itk-c-Iƒ

_©v t]mse {Iao-I-cn-®-Xv)

12.

FIvkvtd bqWn-‰n-te°v

4,000

Bh-iy-amb C\-ßƒ˛

s{]m´-Iv‰ohv _mcn-b¿ seUv

¢mkv

seUv A∏vtdm¨

tKmWmƒUv jo¬Uv

ap≥hm-Xn¬ seUv Ih¿

sNø¬ sskkv 6 1/2 ASn

x 1 3/4 ASn

Z¿Lmkv t^mdØns‚ hne :

A ¬—cq] 400 + 10% \nIp-Xn.

]I¿∏v—cq] 200 + 10% \nIp-Xn.

Z¿Lmkv t^mdw hn¬]\ XpS-ßp∂ XobXn—

20˛2˛2009.

Z¿Lmkv hn¬]\ Ah-km-\n-°p∂ XobXn—27˛2˛2009.

Z¿Lmkv kzoI-cn-°p∂ Ah-km\ XobXnbpw

kabhpw—28˛2˛2009, 11 aWn.

Z¿Lmkv Xpd-°p∂ XobXnbpw kabhpw—28˛2˛2009,

3 aWn.

Izm´v sNøp∂ XpI-bpsS 1% GWÃv aWn

sUt∏m-kn‰v Bbn sS≥U-dn-t\m-sSm∏w kq{]-≠ns‚

t]cn¬ Un. Un. Bbn ka¿∏n-t°-≠-Xm-Wv.

Ih-dn\v apI-fn¬ “Bip-]{Xn D]-I-c-W-ßƒ°p≈

Z¿Lmkv” F∂v tcJ-s∏-Sp-Ø-Ww.

\n_-‘-\-Iƒ

\ne-hmcap≈ C\-ßƒ G‰hpw Ipd™ \nc-°n¬ kssπ

sNøp-∂-Xn\v tcJ-s∏-Sp-Øn-b-h¿°v Dd-∏n-°p-∂Xpw Sn

hy‡n°v 50 cq]-bpsS ap{Z-]-{X-Øn¬ DS-ºSn H∏v h®v

\¬tI-≠-Xp-am-Wv.

Z¿Lmkv Dd-∏n-°p-∂ Sn hy‡n kz¥w DØ-c-hm-Zn-Xz-

Ønepw Nne-hnepw km[-\-ßƒ FØn-®p-X-tc-≠Xpw

C\-ßƒ°v Kymc≠n/hmd≠n \¬tI-≠-Xp-am-Wv.

Z¿Lm-kp-Iƒ Imc-W-c-ln-Xtam A√m-sXtbm \ncm-I-cn-

°p-∂-Xn-\p≈ Ah-Imiw kq{]-≠n¬ \n£n-]vX-am-Wv.

Xmeq-°m-ÿm\ Bip-]{Xn,

(H∏v)

hS-°m-t©cn.

kq{]-≠v.

Department of Industrial Training

QUOTATION NOTICE

No. A8/126/09.

30th January 2009.

Sealed quotations are invited from manufacturers

and authorised dealers for the supply of the machinery

and equipments for training in the food processing trade

to ITI for Women, Kollam-12.

Sl. Quotation

Items

Approximate

No.

Cost (Rs.)

1 A8/121/2009

Mawa machine and steam

jacketed kettle

60,000

2 A8/122/2009

7 items such as moisture

meter and cupsealer

3,00,000

3 A8/123/2009

5 items such as cabinet

dryer and oven

7,75,000

4 A8/124/2009

Refractometer and

electric oven

5,50,000

5 A8/125/2009

Fermentor and pulping

machine

2,50,000

6 A8/126/2009

Fruit mill junior model

8,00,000

7 A8/127/2009

Gel meter and vacuum pan

7,00,000

8 A8/128/2009

6 items such as flour mill

and bread cutting machine

7,50,000

9 A8/129/2009

Packing machine hand

operated

7,00,000

10 A8/130/2009

Sugar coating pan solar

dryer, electric oven

3,90,000

11 A8/131/2009

Automatic pouch machine

5,00,000

12 A8/132/2009

7 items such as Hammer mill

and mini grain mill

3,00,000

13 A8/133/2009

6 items such as wheat flour mill

and vinegar generator

1,60,000

List of items and format of quotation shall have from

this office on working hours. Format shall be sent by

post on request with self addressed, stamped envelope.

Quotation may be submited separately for each of

the above 13 notices.

Last date and time for submission of quotation—

28-2-2009, 2 p. m.

Date and time of opening of tender—

28-2-2009, 2.30 p. m.

sIm√w h-\nXm sF.-Sn.-sF.˛se ^pUv t{]mk- nwKv

t{SUn¬ ]cn-io-e\w \¬Ip-∂-Xn-\p≈ bt{¥m-]-I-c-W-ßƒ

hnX-cWw sNøp-∂-Xn-\mbn ap{Z-h® Izt´-j-\p-Iƒ

£Wn-®psIm≈p-∂p.

{Ia

Izt´-j≥

D]-I-c-W-ßƒ

aXn∏p-hne

\º¿

(cq])

F8/121/09

amh sajo≥

60,000

Ãow Pm°-‰Uv sI‰n¬

F8/122/09

tambvkvN¿ ao‰¿

3,00,000

I]v koe¿ XpS-ßnb

7 D]-I-c-W-ßƒ

F8/123/09

Iym_n-\‰v ss{Ub¿,

7,75,000

Hmh≥ XpS-ßnb

5 D]-I-c-W-ßƒ

F8/124/09

dn{^mIvtSm ao‰¿

5,50,000

CeIv{Sn°v Hmh≥

F8/125/09

s^¿a‚¿

2,50,000

]ƒ∏nwKv sajo≥

F8/126/09

{^q´v an¬ Pq\n-b¿

8,00,000

tamU¬

F8/127/09

P¬ao-‰¿ hmIzw ]m≥

7,00,000

F8/128/09

^vfh¿ an¬

7,50,000

s{_Uv I´nwKv sajo≥

F8/129/09

]m°nwKv sajo≥

7,00,000

lm≥Uv Hm∏-td-‰Uv

F8/130/09

jpK¿tIm-´nwKv ]m≥,

3,90,000

tkmfm¿ss{U-b¿

Ce-Iv{Sn°v Hmh≥

F8/131/09

Bt´m-am-‰n°v ]u®nwKv

5,00,000

sajo≥

F8/132/09

lma¿ an¬,

3,00,000

an\n-s{Kbv≥an¬ XpSßn

7 D]-I-c-W-ßƒ

F8/133/09

ho‰v ^vfh¿ an¬, hn\o-K¿

1,60,000

P\-td-‰¿ XpSßn

6 D]-I-c-W-ßƒ

D]-I-c-W-ß-fpsS enÃpw, Izt´-j≥t^m¿am‰pw {]hrØn

ka-b-ß-fn¬ B^o-kn¬\n∂v e`n-°p-∂-Xm-Wv. X]m-en¬

th≠-h¿ aXn-bmb Ãmºv ]Xn® ta¬-hn-emkw Fgp-Xnb

Ih¿ klnXw Bh-iy-s∏-´m¬ Ab-®p-X-cp-∂-Xm-Wv.

apI-fn¬ sImSp-Øn-´p≈ 13 Izt´-j≥ t\m´o-kp-Iƒ°pw

{]tXyIw Izt´-j≥ \¬tI-≠-Xm-Wv.

Izt´-j≥ e`n-t°≠ Ah-km\ Xob-Xnbpw

ka-bhpw—28-˛2˛2009, 2 aWn.

Izt´-j≥ Xpd-°p∂ Xob-Xnbpw ka-bhpw—

-28˛2˛2009, 2.30 aWn.

Industrial Training Institute

(Sd.)

for Women, Kollam.

Principal.

Phone; 0474-2793714

TENDER NOTICES

(1)

[C4/01/09]

No. C4-54/2009.

21st January 2009.

Sealed competitive tenders are invited for the supply

of Tools and Equipments for Health Sanitory Inspector

Trade of ITI, Chennerkara.

Name of items—Ventilation & Sewerage System and

Treatment plant.

Cost of tender form :

Original—Rs. 169+12.5% VAT.

Duplicate—Rs. 113+12.5% VAT.

Last date of sale of tender form—21-2-2009.

Last date and time of receipt of tender—

28-2-2009, 2 p. m.

Date

and

time

opening

tender—

28-2-2009, 3 p. m.

The cost of tender form will be accepted only by

cash or money order. The tender should be superscribed

with tender number and date and addressed to the

Principal, ITI, Chenneerkara, Pathanamthitta. Late tenders

will not be accepted. One percent of the total cost

quoted should be enclosed as E.M.D. and a validity

period of 3 months from the date of opening of the

tenders should be offered, otherwise the tenders will be

rejected. Tenders in original should be accompanied with

preliminary agreement in Kerala Stamp Paper worth Rs. 50

otherwise the tenders will not be considered. Stamp

Paper will be forwarded to the firm outside Kerala if

required, by remitting Rs. 75 separately by Money Order

(Rs. 25 is needed intended to cover. postage and

incidental expenses). Tender forms are not transferable.

hymh-km-bnI ]cn-io-e\ hIp-∏ns‚ Iogn¬

{]h¿Øn-°p∂ sN-∂o¿°c- sF. Sn. sF. bnse sl¬Øv

km\n-‰dn C≥kv-s]-IvS¿ t{SUn-te°v Xmsg-°m-Wp∂

Sqƒkv B‚ v FIyp-]vsa≥kv hnX-cWw sNøm≥

Xm¬∏-cy-ap≈

ÿm]-\-ß-fn¬

\n∂pw

ap{Z-h®

Z¿Lmkp-Iƒ £Wn-®p-sIm-≈p-∂p.

C\w—sh‚n-te-j≥ B‚ v knh-tdPv knÃw

{So‰vsa‚ v πm‚ v.

Z¿Lmkv t^md-Øns‚ hne :

Hdn-Pn-\¬—cq] 169 + 12.5% hm‰v.

Uyqπn-t°‰v—cq] 113 + 12.5% hm‰v.

Z¿Lmkv t^mdw hn¬°p∂ Ah-km\ Xob-Xn—

21˛2˛2009.

Z¿Lmkv kzoIcn°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—28˛2˛2009, 2 aWn.

Z¿Lmkv Xpd°p∂ Xob-Xnbpw ka-bhpw—28˛2˛2009,

3 aWn.

Z¿Lmkv hne ]W-am-bnt´m aWntbm¿U-dm-bnt´m

am{Xta kzoI-cn-°p-I-bp-≈q. Z¿Lmkv \º¿, XobXn

F∂nh tcJ-s∏-SpØn ap{Z-h® Ih-dpIƒ {]n≥kn-∏mƒ,

sF. Sn. sF., sN∂o¿°-c, ]Ø-\w-Xn´ F∂

hnem-k-Øn¬ Ab-bvt°-≠-Xm-Wv. Xma-kn®p e`n-°p∂

Z¿Lm-kpIƒ kzoI-cn-°p-∂-X-√. Hdn-Pn-\¬ Z¿Lmkv

{]amWtØmsSm-∏w BsI hne-bpsS Hcp iX-am\w

\nc-X-{Zhyhpw 50 cq] (A-ºXv cp] am{Xw) hne-bp≈

tIcf k¿°m¿ ap{Z-∏{XØn¬ {]mY-anI Icm¿ ]{Xhpw

D≠m-bn-cn-t°-≠-Xm-Wv. Z¿Lmkv Xpd-°p∂ XobXn apX¬

aq∂v amkw hsc hne \nc°v {]m_-ey-Øn¬ D≠m-bn-cn-°-Ww.

A√m-Ø-]£w Z¿Lm-kp-Iƒ ]cn-KW-n-°p-∂-X-√.

tIc-f-Øn\v ]pd-Øp≈ Iº-\n-Iƒ°v ap{Z-∏{Xw Bh-iy-ap-

s≠-¶n¬- 75 cq] aWnHm¿U¿ Bbn Ab-®p-X-∂m¬ Cu

B^okn¬\n∂pw ap{Z-∏{Xw hmßn Ab-®p -X-cp-∂-Xm-Wv.

(aWntbm¿U-¿ am{Xta kzoI-cn-°p-I-bp-≈q.) Z¿Lmkv

{]amWw ssIam‰w sNøm≥ ]mSp≈X-√.

SCHEDULE

Sl.

Description of Items

Quantity

No.

Ventilation (dynamic type model)

1 No.

(a) 6mm plywood cabin the 80cm x 200cm

door opening and 45cm x 30cm

Ventilator

Cabin size 1.5m x 1.5m x 2.5m

1 No.

Exhaust fan 300mm in size

1 ,,

Sewarage system and Treatment plant 1 ,,

(Static type Model)

(a) 6mm marine plywood tank

,, 30cm x 30cm x 45cm

2 Nos.

,, 30cm x 20cm x 20cm

3 ,,

30cm x 45cm x 45cm

1 No.

60cm x 20cm x 45cm 1 ,,

30cm x 20cm x 45cm

1 ,,

30cm x 20cm x 20cm

2 Nos.

(b) PVC Pipe 1” diametre

2 Metre

1.5” diametre

2” diametre

2 ,,

(2)

[C4/02/09]

No. C4-55/2009. 21st January 2009.

Sealed competitive tenders are invited for the supply

of Tools and Equipments for Health Sanitory Inspector

Trade of ITI, Chenneerkara.

Name of Items—Water Purification Plant and Waste

Disposal Unit.

Cost of tender form :

Original—Rs. 450+12.5% VAT.

Duplicate—Rs. 225+12.5% VAT.

Last date of sale of tender form—21-2-2009.

Last date and time of receipt of tender—

28-2-2009, 2 p. m.

Date and time of opening of tender—

28-2-2009, 3 p. m.

The cost of tender form will be accepted only by

cash or money order. The tender should be superscribed

with tender number and date and addressed to the

Principal, ITI, Chenneerkara, Pathanamthitta. Late tenders

will not be accepted. One percent of the total cost

quoted should be enclosed as E.M.D. and a validity

period of 3 months from the date of opening of the

tenders should be offered, otherwise the tenders will be

rejected. Tenders in original should be accompanied with

preliminary agreement in Kerala Stamp Paper worth Rs. 50

otherwise the tenders will not be considered. Stamp

Paper will be forwarded to the firms outside kerala if

required by remitting Rs. 75 separately by money order.

(Rs. 25 is intended to cover, postage and incidental

expenses). Tender forms are not transferable.

hymh-km-bnI ]cn-io-e\ hIp-∏ns‚ Iogn¬

{]h¿Øn-°p∂ sN-∂o¿°c- sF. Sn. sF---˛bnse sl¬Øv

km\n-‰dn C≥kv-s]-IvS¿ t{SUn-te°v Xmsg-°m-Wp∂

Sqƒkv B‚ v FIyp-]vsa≥kv hnX-cWw sNøm≥ Xm¬∏-cy-

ap≈ ÿm]-\-ß-fn¬ \n∂pw ap{Z-h® Z¿Lmkp-Iƒ

£Wn-®p-sIm-≈p-∂p.

C\w—hm´¿ ]yqcn-^n-t°-j≥ πm‚ v B‚ v thÃv

Unkvt]m-k¬ bqWn-‰v.

Z¿Lmkv t^md-Øns‚ hne :

Hdn-Pn-\¬—cq] 450 + 12.5% hm‰v.

Uyqπn-t°‰v—cq] 225 + 12.5% hm‰v.

Z¿Lmkv t^mdw hn¬°p∂ Ah-km\ Xob-Xn—

21˛2˛2009.

Z¿Lmkv kzoIcn°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—28˛2˛2009, 2 aWn.

Z¿Lmkv Xpd°p∂ Xob-Xnbpw ka-bhpw—

28˛2˛2009, 3 aWn.

Z¿Lmkv hne ]W-am-bnt´m aWntbm¿U-dm-bnt´m

am{Xta kzoI-cn-°p-I-bp-≈p. Z¿Lmkv \º¿, XobXn

F∂nh tcJ-s∏-SpØn ap{Z-h® Ih-dpIƒ {]n≥kn-∏mƒ,

sF. Sn. sF., sN∂o¿°-c, ]Ø-\w-Xn´ F∂

hnem-k-Øn¬ Ab-bvt°-≠-Xm-Wv. Xma-kn®p e`n-°p∂

Z¿Lm-kpIƒ kzoI-cn-°p-∂-X-√. Hdn-Pn-\¬ Z¿Lmkv

{]amWtØmsSm-∏w BsI hne-bpsS Hcp iX-am\w

\nc-X-{Zhyw 50 cq] hne-bp≈ tIcf k¿°m¿

ap{Z-∏{XØn¬ {]mY-anI Icm¿ ]{Xhpw D≠m-bn-cn-t°-≠-Xm-

Wv. Z¿Lmkv Xpd-°p∂ XobXn apX¬ aq∂v amkw hsc

hne \nc°v {]m_-ey-Øn¬ D≠m-bn-cn-°-Ww. A√m-Ø-

]£w Z¿Lm-kpIƒ ]cn-KW-n-°p-∂-X-√. tIc-f-Øn\p

]pd-Øp≈ Iº-\n-Iƒ°v ap{Z-∏{Xw Bh-iy-aps≠-¶n¬- 75

cq] aWn Hm¿U¿ Bbn Ab-®p-X-∂m¬ Cu

B^okn¬\n∂pw ap{Z-∏{Xw hmßn Ab-®p-X-cp-∂-Xm-Wv.

(aWntbm¿U-¿ am{Xta kzoI-cn-°p-I-bp-≈q.) Z¿Lmkv

{]amWw ssIam‰w sNøm≥ ]mSp≈X-√.

Gaz. No. 8/2009/DTP (Stores).

SCHEDULE

Sl.

Description of Items

Quantity

No.

1 Water Purification Plant (Desk Top static

model 1 No. with following accessories

(a) 4mm thick glass tank 45cmx300cmx30cm 2 Nos.

(b) ,, 20cmx20cmx30cm 1 No.

(d) Flexible tube 15mm dia (white colour) 1.5 m.

(e) PVC Flexible pipe 20 mm dia 1.5 m

(f) PVC hollow cylinder (Model as 1 No.

chlorination Cylinder-45cm long)

Waste Disposal Unit–1 No.

(a) G. I. hollow cylinder—1.5 mm thick, 1 No.

30cm dia 60 cm height with including

feed door, grating and ash door etc.

(b) Hard wood plat form around

the cylinder, 20cm thick, 60 cm dia.

cylinder 1.5 mm thick, 30 cm to 7.5 cm

dia and 30 mm height.

(d) G. I. chimminey with top cover 1.5 mm

thick 7.5 cm dia, 50 cm height.

(3)

[C4/03/09]

No. C4-56/2009. 21st January 2009.

Sealed competitive tenders are invited for the supply

of Sanitory Latrin Equipments for Health Sanitory

Inspector Trade of ITI, Chenneerkara.

Cost of tender form :

Original—Rs. 169+12.5% VAT.

Duplicate—Rs. 113+12.5% VAT.

Last date of sale of tender form—21-2-2009.

Last date and time of receipt of tender from—

28-2-2009, 2 p. m.

Date

and

time

opening

tender—

28-2-2009, 3 p. m.

The cost of tender form will be accepted only by

cash or money order. The tender should be superscribed

with tender number and dates and addressed to the

Principal, ITI, Chenneerkara, Pathanamthitta. Late tenders

will not be accepted. One per cent of the total cost

quoted should be enclosed as E.M.D. and a validity

period of 3 months from the date of opening of the

tenders should be offered, otherwise the tenders will be

rejected. Tenders in original should be accompanied with

preliminary agreement in Kerala Stamp Paper worth Rs. 50.

otherwise the tenders will not be considered. Stamp

Paper will be forwarded to the firm outside Kerala if

required by remitting Rs. 75 separately by money order

(Rs. 25 is intended to cover, postage and incidental

expenses). Tender forms are not transferable.

hymh-km-bnI ]cn-io-e\ hIp-∏ns‚ Iogn¬

{]h¿Øn-°p∂ sN-∂o¿°c- sF. Sn. sF. bnse sl¬Øv

km\n-‰dn C≥kv-s]-IvS¿ t{SUn-te°v km\n-‰dn em{Sn≥

FIyp-]vsa≥kv hnX-cWw sNøm≥ Xm¬∏-cy-ap≈

ÿm]-\-ß-fn¬

\n∂pw

ap{Z-h®

Z¿Lmkp-Iƒ

£Wn-®p -sIm-≈p-∂p.

Z¿Lmkv t^md-Øns‚ hne :

Hdn-Pn-\¬—cq] 169 + 12.5% hm‰v.

Uyqπn-t°‰v—cq] 113 + 12.5% hm‰v.

Z¿Lmkv t^mdw hn¬°p∂ Ah-km\ Xob-Xn—

21˛2˛2009.

Z¿Lmkv kzoIcn°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—28˛2˛2009, 2 aWn.

Z¿Lmkv Xpd°p∂ Xob-Xnbpw ka-bhpw—28˛2˛2009, 3

aWn.

Z¿Lmkv hne ]W-am-bnt´m aWntbm¿U-dm-bnt´m

am{Xta kzoI-cn-°p-I-bp-≈q. Z¿Lmkv \º¿, XobXn

F∂nh tcJ-s∏-SpØn ap{Z-h® Ih-dpIƒ {]n≥kn-∏mƒ,

sF. Sn. sF., sN∂o¿°-c, ]Ø-\w-Xn´ F∂ hnem-k-Øn¬

Ab-bvt°-≠-Xm-Wv. Xma-kn®p e`n-°p∂ Z¿Lm-kp-Iƒ

kzoI-cn-°p-∂-X-√. Hdn-Pn-\¬ Z¿Lmkv {]amWtØmsSm-∏w

BsI hne-bpsS Hcp iX-am\w \nc-X-{Zhyhpw 50 cq]

hne-bp≈ tIcf k¿°m¿ ap{Z-∏{XØn¬ {]mY-anI Icm¿

]{Xhpw D≠m-bn-cn-t°-≠-Xm-Wv. Z¿Lmkv Xpd-°p∂ XobXn

apX¬ aq∂v amkw hsc hne \nc°v {]m_-ey-Øn¬

D≠m-bn-cn-°-Ww.

A√m-Ø-]£w

Z¿Lm-kp-Iƒ

]cn-KW-n-°p-∂-X-√. tIc-f-Øn\v ]pd-Øp≈ Iº-\n-Iƒ°v

ap{Z-∏{Xw Bh-iy-ap-s≠-¶n¬- 75 cq] aWn Hm¿U¿

Bbn Ab-®p-X-∂m¬ Cu B^okn¬\n∂pw ap{Z-∏{Xw

hmßn Ab-®p-X-cp-∂-Xm-Wv. (aWntbm¿U-¿ am{Xta

kzoI-cn-°p-I-bp-≈q). Z¿Lmkv {]amWw ssIam‰w sNøm≥

]mSp≈X-√.

SCHEDULE

Sl.

Description of Item

Quantity

No.

(1)

(2)

(3)

Sanitary Latrin (Dynamic type Model)

1 No. with following accessories

(a) PVC septic tank with 3 compartment 1 No.

100 litter capacity

(b) Soak pit 45 cm.diameter 75 cm height 1 No.

operated with foot rest (standard size)

(d) Q-trap

(e) PVC pipe 10 cm dia meter

3 meters

(f) PVC Tee

1 No.

(g) PVC Vent pipe with top cover 50 mm 1 No.

dia 1.5 long

I.T.I., Chenneerkara,

(Sd.)

Pathanamthitta.

Principal.

SHORT TENDER NOTICES

(1)

No. A2-125/2009.

22nd January 2009.

Sealed tenders are invited for the supply of Revit-

Autocadd inbuilt with Architectural desk top (5 user)—1

No. for Draughtsman Civil trade in connection with

Employment and Finishing School Course 2008-09 at

Government ITI Areacode under Industrial Training

Department.

Cost of tender form :

Original—Rs. 700.

Duplicate—Rs. 300.

Last date and time of sale of tender forms—

27-2-2009, 3 p. m.

Last date and time of receipt of tender forms—

28-2-2009, 3 p. m.

Date and time of opening of tenders—

28-2-2009, 4 p. m.

TERMS AND CONDITIONS

Tenders should be superscripted with tender number

and date and addressed to the Principal, ITI Areacode

Malappuram District. Late tenders will not be accepted.

The tenders will be opened at the time and date given

above in the presents of tenderers or their authorized

representatives who may be present at that time.

Intending tenderers may on application to the

principal obtain the requisite tender forms on which

tender should be submitted. Application for tender forms

should be accompanied by a cash remittance of price of

the form in favour of the Principal, Govt. ITI Areacode,

which is not refundable under any cirucmstances. Those

who wish to get the tender forms by post should send

an extra amount of Rs.10 by way of money order. Tender

forms are not transferable.

Drafts, cheques, postage stamps, postal orders etc.

will not be accepted towards the cost of form and the

form will not be send by VPP. Duplicate tender form will

be issued on remittance of the prescribed cost.

Kerala stamp paper worth Rs. 50 (Rupees fifty only)

is required for executing the agreement along with the

tender. Tender will be supplied to firms outside Kerala

on remittance of Rs. 60 (Rupees sixty only) separately by

Money Order Rs. 10 is intended to cover postage and

incidental expenses.

Along with tender an amount which is not less than

one per cent of the tender value should be enclosed as

security deposit. Security deposit should be in the form

of Demand Draft in favour of the Prncipal, ITI Areacode,

Malappuram District.

hymh-km-bnI ]cn-io-e\ hIp-∏ns‚ Iognep≈

Aco-t°mSv sF. Sn. sF. bnse Fwtπm-bvsa‚ v B‚ v

^n\n-jnwKv kvIqƒ tImgvkns‚ `mK-ambn Un/knhn¬

t{SUn-te-°m-h-iy-amb dnhn‰v Hmt´mImUv C≥ _n¬‰v hnØv

B¿°n-sS-IvNz-d¬ sSkvIv tSm∏v (5 bqk¿)—1 FÆw

hnX-cWw sNøp∂-Xn\v Xmev]-cy-ap≈hcn¬ \n∂pw ap{Z-h®

Z¿Lm-kp-Iƒ £Wn-°p-∂p.

Z¿Lmkv t^md-Øns‚ hne :

Ak¬— cq] 700.

]I¿∏v— cq] 300.

Z¿Lm-kv t^mdw hn¬°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—27˛2˛2009, 3 aWn.

Z¿Lm-kv kzoIcn°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—28-˛2˛2009, 3 aWn.

Z¿Lm-kv Xpd-°p∂ Xob-Xnbpw ka-bhpw—

-28˛2˛2009, 4 aWn.

Z¿Lm-kp-I-fpsS Ih-dn\v ]pdØv \ºcpw Xob-Xnbpw

Fgp-tX-≠-Xm-Wv. Z¿Lm-kp-Iƒ {]n≥kn-∏mƒ, hyh-km-bnI

]cn-io-e\ hIp-∏v, sF.-Sn.-sF. Aco-t°mSv, ae-∏pdw F∂

hnem-k-Øn¬ Ab-bvt°-≠-Xm-Wv. Xma-kn®v e`n-°p∂

Z¿Lm-kp-Iƒ Hcp Imc-W-h-imepw kzoI-cn-°p-∂-X√.

Z¿Lm-kp-Iƒ \n›nX ka-bØv lmP-cm-bn-cn-°p∂ Z¿Lm-kp-

Im-cpsS km∂n-≤y-Øn¬ Xpd-°p-∂-Xm-Wv.

Z¿Lmkv {]am-W-Øn\v \n›nX XpI AS®v

At]-£n-t°-≠-Xm-Wv. Z¿Lmkv hne sF.-Sn.-sF.

Aco-t°mSv, {]n≥kn-∏m-fn\v aWn- Hm¿U¿ Bbn Ab-bv°m-

hp-∂-Xm-Wv. {Um^v‰v, sN°v, t]mÃ¬ Hm¿U¿ F∂o

coXn-I-fn¬ Z¿Lmkv hne kzoI-cn-°p-∂-X-√. Z¿Lmkv

{]amWw hn. ]n. ]n. Bbn e`n-°p-∂-X√. Z¿Lmkv

{]amWw X]m¬ hgn e`n-°m≥ 10 cq] IqSp-X¬ sF. -Sn. -sF.

Aco-t°mSv, {]n≥kn-∏m-fns‚ t]cn¬ aWn Hm¿U¿ Bbn

AS®v At]-£n-t°-≠-Xm-Wv.

Z¿Lmkv {]amWØn¬ sImSp-Øn-´p≈ Icm¿ amXr-I-bn¬

50 cq]bpsS tIcf k¿°m¿ ap{Z-]-{X-Øn¬ IcSv H∏n´v

Z¿Lm-kn-s\m∏w ka¿∏n-t°-≠-Xm-Wv. tIc-f-Øn\v ]pd-Øp≈

Z¿L-m-kp-Iƒ°v ap{Z-]{Xw Z¿Lm-kn-s\m∏w Bh-iy-ap-s≠-¶n¬

60 cq] AS®v At]-£n-t°-≠-Xm-Wv.

Z¿Lm-kp-Iƒs°m∏w Icm¿ XpI-bpsS 1%˛¬ Ipd-bmØ

XpI \nc-X-{Z-hy-ambn sF. Sn. sF. Aco-t°mSv

{]n≥kn-∏m-fns‚ t]cn¬ amdm-hp∂ {Um^v‰mbn AS°w

sNbvXn-cn-t°-≠-Xm-Wv.

Z¿Lmkv {]amWßƒ ssIam‰w sNøm-hp-∂-X-√.

Uyq]vfn-t°‰v Z¿Lmkv {]amWw Bh-iy-ap-≈-h¿ \n›nX

XpI AS-bvt°-≠-Xm-Wv. Z¿Lmkv hne-bmbn AS® XpI

bmsXmcp Imc-W-h-imepw Xncn®v \evIp-∂-X-√.

(1)

(2)

(3)

(2)

No. A2-127/2009.

22nd January 2009.

Sealed tenders are invited for the supply of

Tools for Electric Trade in connection with Employment

and Finishing School Course 2008-09 at Government ITI

Areacode under Industrial Training Department.

SCHEDULE

Sl. No.

Description of Items

Quantity

(Nos.)

Combination players, 200 mm. insulated

Screw Driver, 200 mm

Terminal Screw Driver

Neon Tester, 500v Pencil bit

Knife DB, Electrician

Hammer ball peen 0.25 Kg

Firmers chisel 12 mm

Rached brace 6mm Capacity

Rached bit 4 mm and 6 mm

Hacksaw frame adjustable

200 mm to 300 mm

Steel rule 300 mm

Multimeter 0-1000 m ohm

25 to 500V

Tong Tester

AC Voltmeter MI 0-500V

AC Ammeter MI 0.5A

Merger 500V

Motor Generator set with

panel board

Motor AC three phase

440V 5HP with starter

Cost of tender form :

Original—Rs. 450.

Duplicate—Rs. 200.

Last date and time of sale of tender form—

27-2-2009, 3 p. m.

Last date and time of receipt of tender form—

28-2-2009, 3 p. m.

Date and time of opening of tenders—

28-2-2009, 4 p. m.

TERMS AND CONDITIONS

Tenders should be superscripted with Tender number

and date and addressed to the Principal, ITI Areacode

Malappuram District. Late tenders will not be accepted.

The tenders will be opened at the time and date given

above in the presents of tenderers or their authorized

representatives who may be present at that time.

Intending tenderers may on application to the

principal obtain the requisite tender forms on which

tender should be submitted. Application for tender forms

should be accompanied by a cash remittance of price of

the form in favour of the Principal, Govt. ITI Areacode

which is not refundable under any cirucmstances. Those

who wish to get the tender forms by post should send

an extra amount of Rs.10 by way of Money Order.

Tender forms are not transferable.

Drafts, cheques, postage stamps, postal orders etc.

will not be accepted towards the cost of form and the

form will not be send by VPP. Duplicate tender form will

be issued on remittance of the prescribed cost.

Kerala stamp paper worth Rs. 50 is required for

executing the agreement along with the tender. Tender

will be supplied to firms outside Kerala on remittance of

Rs. 60 separately by Money Order Rs. 10 is intended to

cover postage and incidental expenses.

Along with tender an amount which is not less than

one percent of the Tender value should be enclosed as

security deposit. Secruity deposit should be in the form

of Demand Draft in favour of the Prncipal, ITI Areacode,

Malappuram District.

hyh-km-bnI ]cn-io-e\ hIp-∏ns‚ Iognep≈

Aco-t°mSv sF. Sn. sF.-˛bnse Fwtπm-bvsa‚ v B‚ v ^n\n-

jnwKv kvIqƒ tImgvkns‚ `mK-ambn Ce-Iv{S-o-jy≥

t{SUn-te-°m-h-iy-amb hnhn-[-bn\w Sqƒkp-Iƒ hnX-cWw

sNøp∂-Xn\v Xmev]-cy-ap≈hcn¬ \n∂pw ap{Z-h®

Z¿Lm-kp-Iƒ £Wn-°p-∂p.

{Ia-

kma-{Kn-Iƒ

FÆw

\-º¿

(1)

(2)

(3)

tImºn-t\-j≥sπtbgvkv 200 Fw. Fw.

C≥kp-te-‰Uv

kv{Iqss{Uh¿, 200 Fw. Fw.

sS¿an-\¬ kv{Iqss{Uh¿

\ntbm¨ sSÃ¿, 500 thmƒ´v

s]≥kn¬ _n‰v

ss\^v Un _n, Ce-Iv{So-jy≥

lma¿ _mƒ]o≥ 0.25 Intem

t^tagvkv Nnk¬ 12 Fw. Fw.

td®vUv s{_bvkv 6 Fw. Fw.

I∏m-kn‰n

td®vUv _n‰v 4 Fw. Fw.

B‚ v 6 Fw. Fw.

lmIvkm s{^bnw AUvP-Ã-_nƒ

200 Fw. Fw. apX¬ 300 Fw.- Fw. hsc

Ão¬ dqƒ 300 Fw. Fw.

aƒ´nao‰¿ 0˛1000 an√n Hmw 25-˛500 thmƒ´v

SwKv sSÃ¿

F. kn. thmƒ´-v -ao-‰¿ Fw. sF. 0˛500 thmƒ´v

F. kn. AΩo-‰¿ Fw. sF. 0˛5 F

sa¿P¿ 500V

tamt´m¿ P\-td-‰¿ sk‰v hnØv

]m\¬ t_m¿Uv

tamt´m¿ F. kn. {Xo t^kv 440V 5F-®v. ]n.

hnØv Ãm¿´¿

Z¿Lmkv t^md-Øns‚ hne :

A ¬—cq] 450.

]I¿∏v—cq] 225.

Z¿Lm-kv

hn¬°p∂

Ah-km\

Xob-Xnbpw

ka-bhpw—27˛2˛2009, 3 aWn.

Z¿Lm-kv kzoIcn°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—28-˛2˛2009, 3 aWn.

Z¿Lm-kv Xpd-°p∂ Xob-Xnbpw ka-bhpw—

-28˛2˛2009, 4 aWn.

Z¿Lm-kp-I-fpsS Ih-dn\v ]pdØv \ºcpw Xob-Xnbpw

Fgp-tX-≠-Xm-Wv. Z¿Lm-kp-Iƒ {]n≥kn-∏mƒ, hymh-km-bnI

]cn-io-e\ hIp-∏v, sF.-Sn.-sF., Aco-t°mSv, ae-∏pdw F∂

hnem-k-Øn¬ Ab-bvt°-≠-Xm-Wv. Xma-kn®v e`n-°p∂

Z¿Lm-kp-Iƒ Hcp Imc-W-h-imepw kzoI-cn-°p-∂-X√.

Z¿Lm-kp-Iƒ \n›nX ka-bØv lmP-cm-bn-cn-°p∂

Z¿Lm-kp-Im-cpsS km∂n-≤y-Øn¬ Xpd-°p-∂-Xm-Wv.

Z¿Lmkv {]am-W-Øn\v \n›nX XpI AS®v

At]-£n-t°-≠-Xm-Wv. Z¿Lmkv hne sF.-Sn.-sF.

Aco-t°mSv {]n≥kn-∏m-fn\v aWn-Hm¿U¿ Bbn Ab-bv°m-hp-

∂-Xm-Wv. {Um^v‰v, sN°v, t]mÃ¬ Hm¿U¿ F∂o

coXn-I-fn¬ Z¿Lmkv hne kzoI-cn-°p-∂-X-√. Z¿Lmkv

{]amWw hn. ]n. ]n. Bbn e`n-°p-∂-X√. Z¿Lmkv

{]amWw X]m¬ hgn e`n-°m≥ 10 cq] IqSp-X¬ sF.-Sn.-sF.

Aco-t°mSv {]n≥kn-∏m-fns‚ t]cn¬ aWn Hm¿U¿ Bbn

AS®v At]-£n-t°-≠-Xm-Wv.

Z¿Lmkv {]amWØn¬ sImSp-Øn-´p≈ Icm¿ amXr-I-bn¬

50 cq]bpsS tIcf k¿°m¿ ap{Z-]-{X-Øn¬ IcSv H∏n´v

Z¿Lm-kn-s\m∏w ka¿∏n-t°-≠-Xm-Wv. tIc-f-Øn\v ]pd-Øp≈

Z¿L-m-kp-Iƒ°v ap{Z-]{Xw Z¿Lm-kn-s\m∏w Bh-iy-ap-s≠-¶n¬

60 cq] AS®v At]-£n-t°-≠-Xm-Wv.

Z¿Lm-kp-Iƒs°m∏w Icm¿ XpI-bpsS 1%˛¬ Ipd-bmØ

XpI \nc-X-{Z-hy-ambn sF. Sn. sF. Aco-t°mSv

{]n≥kn-∏m-fns‚ t]cn¬ amdm-hp∂ {Um^v‰mbn AS°w

sNbvXn-cn-t°-≠-Xm-Wv.

Z¿Lmkv {]amWßƒ ssIam‰w sNøm-hp-∂-X-√.

Uyq]vfn-t°‰v Z¿Lmkv {]amWw Bh-iy-ap-≈-h¿ \n›nX

XpI AS-bvt°-≠-Xm-Wv. Z¿Lmkv hne-bmbn AS® XpI

bmsXmcp Imc-W-h-imepw Xncn®v \¬Ip-∂-X-√.

Industrial Training Institute,

(Sd.)

Areacode, Malappuram.

Principal.

Irrigatio

Irrigation Department

n Department

]p\¿ Z¿Lmkv ]ckyw

\º¿ Un.3˛846/2008(F).

2009 P\p-hcn 28.

sa°m-\n-°¬ Unhn-j≥, Be-∏pg Xmsg ]d-bp∂

kma-{Kn-Iƒ kssπ sNøp-∂-Xn¬ a¬k-c-kz-`m-h-ap≈

ap{Zh® Z¿LmkpIƒ £Wn-®p-sIm-≈p-∂p.

Z¿Lmkv \º¿—8/CC/2008-˛09.

kma-{Kn-bpsS t]cpw FÆhpw:

1. d∫¿ tamƒUvUv slhnUyq´n kIvj≥

Fw. Fw. H.Un 381 Fw. Fw. \ofw 2440 Fw.

Fw. (kmºnƒ {]Im-cw)—1

2. 2

{UUvP¿

d∫¿

…ohv

\ofw

475

Fw. Fw. sF. Un. 260 Fw. Fw. H. Un 311

Fw. Fw. (kmºnƒ {]Im-cw)—15

\nc-X-{Zhyw—Izm´v sNøp∂ XpI-bpsS 1%

Z¿Lmkv {]am-W-ß-fpsS hne—cq] 400 + F v. ‰n.

sa°m-\n-°¬ Unhn-j≥ Be-∏p-g-bpsS Imcym-e-b-Øn¬

\n∂v 20-˛2-˛2009 apX¬ 28-˛2-˛2009 hsc {]h¿Øn

Znhk-ß-fn¬ cm-hnse 11 aWn-ap-X¬ D®bv°v 1 aWn-hsc

e`n-°p-∂-Xm-Wv.

Z¿Lmkv kzoI-cn-°p∂ Xob-Xnbpw ka-bhpw—

28-˛2-˛2009, 4 aWn.

Z¿Lmkv Xpd-°p∂ Xob-Xnbpw ka-bhpw—28-˛2-˛2009,

4.30 aWn.

Imem-h[n—15 Znhkw

a‰p hyh-ÿ-Iƒ

1. Z¿Lmkv {]am-W-Øn-\p≈ At]-£-tbm-sSm∏w

kam\ {]h¿ØnIfn¬ ]cn-Nbw ImWn-°p∂ km£y

-]{Xw lmP-cm-t°-≠-Xm-Wv.

2. -Z¿Lmkv kw_-‘n®v Pe-hn-`h hIp-∏n¬ \ne-hn-ep≈

F√m hyh-ÿ-Ifpw Cu Z¿Lm-kn\pw _m[-I-am-Wv.

3. \n›nX kabw Ign-™p-e-`n-°p∂ Z¿Lm-kp-Iƒ

kzoI-cn-°p-∂-X-√.

4. {]am-W-ßƒ X]m-embn Bh-iy-ap-≈-h¿ {]am-W

-Øns‚ hne-tbm-sSm∏w 50 cq] IqSn X]m¬

sNe-hn-\mbn Ab-bvt°-≠-Xm-Wv.

sa°m-\n-°¬ Unhnj≥,

(H-∏v)

Be-∏pg.

Gaz. No. 8/2009/DTP (Stores).

(1)

(2)

(3)

Medical Education Department

TENDER NOTICE

No. C8/22350/2008/MCT.

2nd January 2009.

Sealed competitive tenders are invited for the supply

of Journals for the Central Library of Medical College,

Thiruvananthapuram.

Tenders should be superscribed as “C8/22350/08/

MCT-Journals for Central Library 2008-09”. and addressed

to the Principal, Medical College, Thiruvananthapuram,

Pin-695 011. Details can be had from this office on

working hours till 3.30 p. m.

Tender No.—171/2008.

Cost of tender form (inclusive Sales Tax):

Original—Rs. 450.

Duplicate—Rs. 225.

Last date and time for sale of tender form—

2-3-2009, 3. 30 p. m.

Last date and time for receipt of tender form—

3-3-2009 at 2.30 p. m.

Date and time for opening of tender—3-3-2009

at 3 p. m.

Tender forms will be sent through post if required

provided due amount with sufficient postage charges

(Rs. 50) is sent by way of Money Order in favour of the

Principal, Medical College, Thiruvananthapuram, Kerala

State, Pin-695 011. Money Order should reach this Office

on or before 24-2-2009. No other forms of remittance

will be accepted.

Xncph\¥]pcw saUn°¬ tImtfPnte sk≥{S¬

sse{_dnbnte°v Bhiyamb tP¿W¬ hnXcWw

sNøp∂Xn\v ap{Zh® Z¿LmkpIƒ £Wn°p∂p.

Z¿LmkpIƒ Z¿Lmkv \ºtcmSpIqSn \n›nX

XobXn°papºv {]n≥kn∏mƒ, saUn°¬ tImtfPv,

Xncph\¥]pcw˛695 011

F∂

hnemkØn¬

FØn®ncnt°≠XmWv.

Z¿Lmkv \º¿-˛171/2008.

Z¿Lmkv t^mdØns‚ hne (\nIpXnIƒ Dƒs∏sS):

A ¬—cq] 450.

]I¿∏v—cq] 225.

Z¿Lmkv t^mdw hn¬°p∂ Ahkm\ XobXnbpw

kabhpw—2˛3˛2009, 3.30 aWn.

Z¿Lmkv kzoIcn°p∂ Ahkm\ XobXnbpw

kabhpw—3˛3˛2009, 2.30 aWn.

Z¿Lmkv t^mdw Xpd°p∂ XobXnbpw kabhpw—

3˛3˛2009, 3 aWn.

t^mdßƒ X]men¬ th≠h¿ Abbv°p∂Xn\p

th≠ XpI (cq] 50) A[nIambn Abbvt°≠XmWv.

Z¿Lmkv t^mdØns‚ hne Hm^okn¬ t\cnt´m

aWntbm¿U¿ Btbm kzoIcn°p∂XmWv. A√msXbp≈

F√m At]£Ifpw \nckn°p∂XmWv. t^mdtØmsSm∏w

ap{Z]{Xßtfm at‰sX¶nepw tUmIypsa‚pItfm Abbv°m≥

Bhiys∏´psIm≠p≈Xpw

ta¬hnemkw

hy‡

a√mØXpamb aWntbm¿UdpIƒ \nckn°p∂XmWv.

aWntbm¿UdpIƒhgn t^mdßƒ Bhiys∏´psIm≠p≈

At]£Iƒ Cu Hm^okn¬ 24˛2˛2009˛\v ap≥]v

In´nbncn°Ww. Xmakn®p In´p∂ aWntbm¿UdpIƒ

\nckn°p∂XmWv. Z¿Lmkv t^mdw ssIamdm≥

]mSn√mØXpw Hcn°¬ AS® XpI Xncn®p In´p∂Xpa-√m-

Ø-Xm-Wv. Xmakn®p In´p∂ Z¿LmkpIƒ bmsXmcp

ImcWhimepw kzoIcn°p∂X√. IqSpX¬ hnhcßƒ

{]hrØn Znhkßfn¬ Cu B^okn¬ \n∂pw

e`n°p∂XmWv.

Medical College,

(Sd.)

Thiruvananthapuram.

Principal.

Technical Education Department

SHORT TENDER NOTICE

No. P4-7837/2008/CS.

17th January 2009.

P4-7838/2008/CS.

P4-7915/2008/E&C

P4-8182/2008/CCF.

Sealed tenders are invited for the supply of the

following equipments for the use of Various Departments

of College of Engineering, Thiruvananthapuram.

Sl. No.

Tender No. and Item

(1)

(2)

Computer Science and Engineering Department

1 16/2008/P4/CS (1)

External Portable Slim USB 2.0

Laptop DVD writer—3

(2)

DVD Sata writer Dual Layer Box

Pack—4

(3)

Slim size Usb Hard Disk Drive

160Gb/Grater—3

(4)

RJ-45/RJ 12/RJ 11 Crimper—5

(5)

Optical mouse with pad—5

(6)

USB Multimedia keyboard—4

(7)

1 GB DDR RAM I/400 MHz—7

(8)

Print Server-RJ 45 Network Speed

10/100 Mbps Printer—1

Interface: USB 1.1/grater

(9)

White board marker—40

2 17/2008/P4/CS (1)

Cat 6 UTP Cable (300 mts/box)—

4 boxes

(2)

Cat 6 KM8 modular jack with

SMB and interface plate—40

(3)

Patch Panel: Cat 6 Angular Patch

Panel—2

(4)

RJ 45 to RJ 45 Patch Cords: Cat 6

Patch cords 1mtr—40

(5)

RJ 45 to RJ 45 Patch Cords: Cat 6

Patch cords 2mtr—40

Electronics and Communication Engineering Department

3 18/2008/P4E&C

Electronic Components (Various

items)

Central Computer Facility

4 19/2008/P4/CCF

UPS Backup batteries—9 Nos.

EP-12-100, 100AH

12 volt SMF Battery

Cost of tender forms:

Original—Rs. 450.

Duplicate—Rs. 225.

By post —Rs. 490.

Last date and time of sale of tender form—

24-2-2009 at 2 p. m.

Last date and time of receipt of tender—25-2-2009

at 3 p. m.

Date and time of opening of tender—26-2-2009 at

11 a. m. for Sl.Nos. 1 and 2, 26-2-2009, 12 Noon for Sl.

Nos. 3 and 4.

Intending tenderers may on application to the

undersigned to obtain the requisite tender form on which

tenders should be submitted. Application for the tender

form should be accompanied by a remittance of above

prices fixed for the same and which is non-refundable

under any circumstances. The tender forms are not

transferable. Cost of tender form is only acceptable by

Money Order or cash remittance to this office. As per

condition the tenderer should send along with his tender

an agreement executed and signed in Kerala Stamp Paper

value of Rs. 50 and Earnest Money Deposit 1% of the

total cost of articles tendered. Tenders without agreement,

tender form and Earnest Money Deposit will be rejected.

Kh¨sa‚ v F≥Pn\obdnwKv tImtf-Pnse hnhn[

F≥Pn\obdnwKv

hIp-∏pI-fn-te°v

Bh-iy-amb

km[-\-km-a-{K-an-Iƒ hnX-cWw sNøm≥ Xm¬]-cy-ap≈

ÿm]-\-ß-fn¬ \n∂pw ap{Z-h® Z¿Lm-kpIƒ

£Wn®psIm≈p-∂p.

{Ia \º¿

Z¿Lmkv \ºcpw C\hpw

(1)

(2)

Iºyq-´¿ kb≥kv B‚ v F≥Pn\obdnwKv

Un∏m¿´p-sa‚ v

16/2008/]n4/kn.Fkv (1) FIvtÃ-W¬ t]m¿´-_nƒ …nw

bp. Fkv. _n 2.0 em]vtSm∏v

Un.-hn.-Un., ssd‰¿—3

(2) Un.- hn. Un. km‰m ssd‰¿ Uyqh¬

teb¿ t_mIvkv ]m°v—4

(3) …nw sskkv bp .F-k-v. _n.

lm¿Uv UnkvIv ss{Uhv 160

Pn. _n/t{K‰¿—3

(4) B¿. sP 45/B¿. sP 12/B¿. sP.

11/{Inw]¿—3

(5) Hm]v‰n°¬ aukv hnØv ]mUv—5

(6) bq Fkv. _n aƒ´n aoUnb

Iot_m¿Uv—4

(7) 1 Pn _n Un Un B¿ dmw

1/400

MHz —7

(8) {]n‚ v sk¿h¿ B¿. sP 45

s\‰v h¿°v kv]oUv 10/100 Fw.-

_ n . - ] n . - F k v . { ] n ‚ ¿ — 1

C‚¿s^bvkv bpFkv_n 1.1-/

t{K‰¿

(9) ssh‰v t_m¿Uv am¿°¿—40

2 17/2008/]n4/kn.Fk.v (1) Im‰v

bpSn]n

tI_nƒ

(300 mts box) 4 t_mIvkkv

(2) Im‰v 6 sI Fw 8 tamU-ep¿

Pm°v

hnØv Fkv Fw _n

B‚ v t^kv tπ‰v˛40

(3) ]m®v ]m\¬ : Im‰v 6 B≥Kp-e¿

]m®v Nm\¬-˛2

(4) B¿. sP 45

‰p B¿.sP. 45

] m ® v t I m U v k v I m ‰ v

6 ]m®vtImUvkv : 1 ao‰¿-˛40

(5) B¿ sP 45 ‰p B¿ sP 45 ]m®v

tImUvkv Im‰v 6 ]m®v tImUvk :v

2 ao‰¿˛40

Ce-Ivt{Sm-WnIvkv B‚ v IΩyp-Wn-t°-j≥

Un∏m¿´p-sa‚ v

3 18/2008/]n4/C.B‚ v kn—Ce-Ivt{Sm-WnIvkv

Itºm-W‚ vkv (hnhn[ Xcw)

sk≥{S¬ Iºyq-´¿ s^kn-en‰n

4 19/2008/]n4/kn kn F^v—bp]n-Fkv _m°v A]v

_m‰-do-kv-˛9 FÆw (EP-12-100, 100

AH 12 volt SMF Battery)

Z¿Lmkv ^md-Øns‚ hne :

Hdn-Pn-\¬—450 cq]

Uyq]vfnt°‰v—225 cq]

X]m¬ hgn—490 cq].

Z¿Lmkv t^mdØns‚ hn¬∏-\-bpsS Ahkm\

XobXnbpw kabhpw—24˛2˛2009, 2 aWn.

Z¿Lmkv kzoIcn°p∂ Ahkm\ XobXnbpw

kabhpw— 25˛2˛2009, 3 aWn.

Z¿Lmkv Xpd°p∂ XobXnbpw kabhpw— {Ia

\º¿ 1˛-\pw 2˛\pw 26˛2˛2009, 11 aWn., {Ia\º¿ 3˛\pw,

4˛\pw 26-˛2-˛2009, 12 aWn.

Z¿Lmkv hne ]W-am-bn-t´m aWn-tbm¿U¿ Bbnt´m

am{Xta kzoIcn°pIbp-≈q. Z¿Lmkv \º¿, XobXn

F∂nh

tcJ-s∏-SpØn,

ap{Zh®

Ih-dp-Iƒ

{]n≥kn-∏mƒ, F≥Pn\obdnwKv tImtf-Pv, Xncp-h-\-¥-]p-cw-˛16

F∂ ta¬hnem-k-Øn¬ Ab-bvt°-≠-Xm-Wv. Xma-kn®p

e`n-°p∂

Z¿Lm-kp-Iƒ

]cn-K-Wn-°p-∂-X√.

Hdn-Pn-\¬ Z¿Lmkv {]am-W-tØm-sSm∏w BsI hne-bpsS

1 % \nc-X-{Zhyhpw 50 cq]- hn-e-bp≈ tIcf ap{Z-]-{X-Øn¬

{]mY-anI Icm¿ ]{Xhpw D≠m-bn-cn-t°-≠-Xm-Wv.

Z¿Lmkv Xpd-°p∂ XobXn apX¬ Bdp amkwhsc

hne \nc-°n\v {]m_eyw D≠m-bn-cn-t°-≠-Xm-Wv. Z¿Lmkv

{]amWw ssIam‰w sNøm≥ ]mSn-√m-Ø-Xm-Wv.

Govt. College of Engineering,

(Sd.)

Thiruvananthapuram. Principal.

(1)

(2)

(1)

(2)

TENDER NOTICES

(1)

No. A3-840/2008.

19th January 2009.

Sealed tenders are invited for the supply of

Lab Equipments in Electronic Branch of Government

Polytechnic College, Nedumkandam.

The tender should be superscribed No. A3-840/2008

supply of Electronic Branch Equipments in the Electronics

Department of this institution and addressed with the

Principal, Government Polytechnic College, Nedumkandam

before 3 p.m. on 25-2-2009.

Late tenders will not be

accepted.

Tender will be opened at 3 p. m. on 26-2-2009

in the presence of the tenderers or their representatives

who may be present at that time.

Inviting tenders may on application to Principal

obtain the requisite tender form on which tender should be

submitted.

Application for the tender form should be

accompanied by a cash remittance of Rs. 400 + VAT which

is fixed for a form and which is not refundable under any

circumstances. Duplicate tender forms will available for

cost of Rs. 200+ VAT. The tender forms are not

transferable, sale will be closed on 25-2-2009 at

2 p.m.

Cheque, Postage Stamps will not be accepted

towards the cost of form nor will the form be sent by V.P.P.

Earnest Money Deposit @ 1% of total cost of Cotton

items by means of Demand Draft in favour of Principal,

Government Polytechnic College, Nedumkandam.

P. A. C.—Rs. 1,96,450.

s\Sp¶≠w

Kh¨sa‚ v

t]mfn-sSIv\nIv

hnX-cWw sNøp-∂-Xn-\mbn ap{Z-h® Z¿Lm-kp-Iƒ

£Wn-®psIm-≈p-∂p.

Ih-dn\papI-fn¬ ""\º¿ F3˛840-/2008 s\Sp¶≠w

Kh¨sa‚ v t]mfn-sSIv\nIv tImtf-Pn¬ Ce-Ivt{Sm-Wn°v

em_v D]-I-cWßƒ hnX-cWw sNøp-∂-Xn-\mbn''

Fs∂-gp-Xnb Z¿Lmkv AS°wsNbvX Ih¿ {]n≥kn-∏mƒ,

Kh¨sa‚ v t]mfn-sS-Iv\nIv tImtfPv, s\Sp-¶≠w˛685 553

F∂ hnem-k-Øn¬ 25-˛2-˛2009, 3 aWn°papºmbn

e`n-®n-cn-°-Ww.

sshIn-°n-´p∂ Z¿Lm-kp-Iƒ bmsXmcp

Imc-W-h-imepw kzoI-cn-°p-∂-X-√.

Z¿Lm-kp-Iƒ 26˛2-˛2009

]I¬ 3 aWn°v lmP-cmb Z¿Lm-kp-Im-cp-sStbm Ah¿

A[n-Im-c-s∏-Sp-Ønb {]Xn-\n-[n-I-fp-sStbm km∂n≤yØn¬

Xpd-°p-∂-Xm-Wv.

Xm¬∏cyapf-f-h¿ Z¿Lmkv t^mdØns‚ hne-bmb

400 cq] + hm‰v B^o-kn¬ AS®v e`n-°p∂

t^md-Øn¬ Z¿Lm-kp-Iƒ \¬I-Ww.

Z¿Lmkv t^mdw

X]m¬ hgn Bh-iy-ap-f-f-h¿ X-]m¬ Nm¿Pv 50 cq] IqSn

tN¿Øv aWn Hm¿U¿ Abbv-t°≠Xm-Wv.

Z¿Lmkv

t^md-ßƒ am‰-Øn\v hnt[-b-a-√.- Uyq-πn-t°‰v t^md-Øns‚

hne cq] 200+hm‰v Bbn-cn-°pw. Z¿Lmkv t^mdØns‚

hn¬∏\ 25-˛2˛2009 ]I¬ 2 aWn°v Ah-km-\n-°p-∂-

Xm-Wv. IqSp-X¬ hnh-c-ßƒ Hm^okn¬\n∂pw t\cn´v

Adn-bm-hp-∂-Xm-Wv. Izm´v sNbvX D]-I-c-W-Øns‚ BsI

hne-bpsS Hcp iX-am-\-Øn-\p≈ Unam‚ v {Um^v‰v

s\Sp-¶-≠Øv amd-Ø-°-hn-[-Øn¬ {]n≥kn-∏m-fns‚ t]cn¬

FSpØv \nc-X-{Z-hy-ambn ka¿∏n-t°-≠-Xm-Wv.

AS-¶¬ XpI—1,96,450 cq].

(2)

No. A3-843/2008.

19th January 2009.

Sealed tenders are invited for the supply of

Lab Equipments in Computer Hardware Maintenance

Branch of Government Polytechnic College,

Nedumkandam.

The tender should be superscribed No. A3-843/2008

supply of Electronics Branch Equipments in the Computer

Hardware Maintenance Department of this institution and

addressed with the Principal, Government Polytechnic

College, Nedumkandam before 3 p.m. on 25-2-2009.

Late

tenders will not be accepted.

Tender will be opened at

3 p. m. on 26-2-2009 in the presence of the tenderers or

their representatives who may be present at that time.

Inviting tenders may on application to Principal

obtain the requisite tender form on which tender should be

submitted.

Application for the tender form should be

accompanied by a cash remittance of Rs. 400 + VAT which

is fixed for a form and which is not refundable under any

circumstances. Duplicate tender form will be available for

cost of Rs. 200+ VAT. The tender forms are not

transferable. The sale will be closed 25-2-2009 at on

2 p.m.

Cheque, Postage stamps will not be accepted

towards the cost of form nor will the form be sent by V.P.P.

Earnest Money Deposit @ 1% of total cost of Cotton

items by means of Demand Draft in favour of Principal,

Government Polytechnic College, Nedumkandam.

P. A. C.—Rs. 1,26,550.

s\Sp¶≠w

Kh¨sa‚ v

t]mfn-sSIv\nIv

te°v D]-I-cWßƒ hnX-cWw sNøp-∂-Xn-\mbn

ap{Z-sh® Z¿Lm-kp-Iƒ £Wn-®psIm-≈p-∂p.

Ih-dn\papI-fn¬ \º¿ F3˛843-/2008 s\Sp¶≠w

Kh¨sa‚ v t]mfn-sSIv\nIv tImtf-Pn¬ Iºyq-´¿

lm¿Uv shb¿ sabn‚-\≥kv em_v D]-I-cWßƒ

hnX-cWw sNøp-∂Xn-\mbn Fs∂-gp-Xnb Z¿Lmkv AS°w

sNbvX Ih¿ {]n≥kn-∏mƒ, Kh¨sa‚ v t]mfn-sS-Iv\nIv

tImtfPv, s\Sp-¶≠w˛685 553 F∂ hnem-k-Øn¬

25-˛2-˛2009˛\v 3 aWn°v apºmbn e`n-®n-cn-°-Ww.

sshIn-°n-´p∂ Z¿Lm-kp-Iƒ bmsXmcp Imc-W-h-imepw

kzoI-cn-°p-∂-X-√.

Z¿Lm-kp-Iƒ 26˛2-˛2009, ]I¬ 3 aWn°v

lmP-cmb Z¿Lm-kp-Im-cp-sStbm Ah¿ A[n-Im-c-s∏-Sp-Ønb

{]Xn-\n-[n-I-fp-sStbm km∂n≤yØn¬ Xpd-°p-∂-Xm-Wv.

Xm¬∏cyapf-f-h¿ Z¿Lmkv t^mdØns‚ hne-bmb 400

cq] + hm‰v B^o-kn¬ AS®v e`n-°p∂ t^md-Øn¬

Z¿Lm-kp-Iƒ \¬I-Ww.

Z¿Lmkv t^mdw X]m¬hgn

Bh-iy-ap-f-f-h¿ X-]m¬ Nm¿Pv 50 cq] IqSn tN¿Øv

aWn Hm¿U¿ Abbv-t°≠Xm-Wv.

Z¿Lmkv t^md-ßƒ

am‰-Øn\v hnt[-b-a-√.- Uyq-πn-t°‰v t^md-Øns‚ hne cq]

200+hm‰v Bbn-cn-°pw. Z¿Lmkv t^mdØns‚ hn¬∏\

25-˛2˛2009, 2 aWn°v Ah-km-\n-°p-∂-Xm-Wv. IqSp-X¬

hnh-c-ßƒ Hm^okn¬ \n∂pw t\cn´v Adn-bm-hp-∂

-Xm-Wv. Izm´v sNøp∂ D]-I-c-W-Øns‚ BsI hne-bpsS

Hcp

iX-am-\-Øn-\p≈

Unam‚ v

{Um^v‰v

s\Sp-¶-≠Øv amd-Ø-°-hn-[-Øn¬ {]n≥kn-∏m-fns‚ t]cn¬

FSpØv \nc-X-{Z-hy-ambn ka¿∏n-t°-≠-Xm-Wv.

AS-¶¬ XpI—cq] 1,26,550

(3)

No. A3-846/2008.

19th January 2009.

Sealed tenders are invited for the supply of

Lab Equipments in Computer Branch of Government

Polytechnic College, Nedumkandam.

The tender should be superscribed No. A3-846/2008

supply of Computer Branch Equipments in the Computer

Department of this institution and address with the

Principal, Government Polytechnic College, Nedumkandam

before 3 p.m. on 25-2-2009.

Late tenders will not be

accepted.

Tender will be opened at 3 p. m. on 26-2-2009

in the presence of the tenderers or their representatives

who may be present at that time.

Inviting tenders may on application to Principal

obtain the requisite tender form on which tender should be

submitted.

Application for the tender forms should be

accompanied by a cash remittance of Rs. 400 + VAT which

is fixed for a form and which is not refundable under any

circumstances. Duplicate tender form will be available for

cost of Rs. 200+ VAT. The tender forms are not

transferable, sale will be closed on 25-2-2009 at

2 p.m.

Cheque, Postage Stamps will not be accepted

towards the cost of form nor will the form be sent by V.P.P.

Earnest Money Deposit @ 1% of total cost of quoted

items by means of Demand Draft in favour of Principal,

Government Polytechnic College, Nedumkandam.

P. A. C.—Rs. 1,72,885.

s\Sp¶≠w

Kh¨sa‚ v

t]mfn-sSIv\nIv

hnX-cWw sNøp-∂-Xn-\mbn ap{Z-h® Z¿Lm-kp-Iƒ

£Wn-®psIm-≈p-∂p.

Ih-dn\papI-fn¬ \º¿ F3˛846-/2008 s\Sp¶≠w

Kh¨sa‚ v t]mfn-sSIv\nIv tImtf-Pn¬ Iºyq-´¿ em_v

D]-I-cWßƒ hnX-cWw sNøp-∂-Xn-\mbn Fs∂-gp-Xnb

Z¿Lmkv AS°wsNbvX Ih¿ {]n≥kn-∏mƒ, Kh¨sa‚ v

t]mfn-sS-Iv\n°v tImtfPv, s\Sp-¶≠w˛685 553 F∂

hnem-k-Øn¬

25-˛2-˛2009,

aWn°v

apºmbn

e`n-®n-cn-°-Ww.

sshIn-°n-´p∂ Z¿Lm-kp-Iƒ bmsXmcp

Imc-W-h-imepw kzoI-cn-°p-∂-X-√.

Z¿Lm-kp-Iƒ 26˛2-˛2009

]I¬ 3 aWn°v lmP-cmb Z¿Lm-kp-Im-cp-sStbm Ah¿

A[n-Im-c-s∏-Sp-Ønb {]Xn-\n-[n-I-fp-sStbm km∂n≤yØn¬

Xpd-°p-∂-Xm-Wv.

Xm¬∏cyapf-f-h¿ Z¿Lmkv t^mdØns‚ hne-bmb

400 cq] + hm‰v B^o-kn¬ AS®v e`n-°p∂

t^md-Øn¬ Z¿Lm-kp-Iƒ \¬I-Ww.

Z¿Lmkv t^mdw

X]m¬hgn Bh-iy-ap-f-f-h¿ X-]m¬ Nm¿Pv 50 cq] IqSn

tN¿Øv aWn Hm¿U¿ Abbv-t°≠Xm-Wv.

Z¿Lmkv

t^md-ßƒ am‰-Øn\v hnt[-b-a-√.- Uyq-πn-t°‰v t^md-Øns‚

hne cq] 200+hm‰v Bbn-cn-°pw. Z¿Lmkv t^mdØns‚

hn¬∏\ 25-˛2˛2009 ]I¬ 2 aWn°v Ah-km-\n-°p-∂-Xm-Wv.

IqSp-X¬ hnh-c-ßƒ Hm^okn¬ \n∂pw t\cn´v

Adn-bm-hp-∂-Xm-Wv. Izm´v sNøp∂ D]-I-c-W-Øns‚ BsI

hne-bpsS Hcp iX-am-\-Øn-\p≈ Unam‚ v {Um^v‰v

s\Sp-¶-≠Øv amd-Ø-°-hn-[-Øn¬ {]n≥kn-∏m-fns‚ t]cn¬

FSpØv \nc-X-{Z-hy-ambn ka¿∏nt°-≠-Xm-Wv.

AS-¶¬ XpI—cq] 1,72,885.

Office of the Principal,

(Sd.)

Government Polytechnic

Head of Section .

College, Nedumkandam.

(In charge of Principal).

SHORT TENDER NOTICE

No. B. 648/2008.

19th January 2009.

Sealed short tenders are invited for the supply of

Computer Hardware items to the Computer Hardware

Maintanance Lab of Government Polytechnic College,

Meppadi. The envelop should be superscribed with

“Tender Number and due date” and addressed to the

office of the undersigned.

Cost of tender forms—Rs. 440 + 12.5% VAT.

Due date and time of tender—27-2-2009, 10 a. m.

Last date and time of sale of tender forms—

27-2-2009, 10 a. m.

Date and time of opening of tenders—27-2-2009,

3 p. m.

The intending tenderers may on their application will

get the tender forms from the office of the undersigned

during the office hours. The tender should be enclosed

with 1% of the total estimated tender cost. The late and

incomplete tenders will not be accepted. Those who wish

to obtain the tender forms through registered post should

send the cost of tender forms and Rs. 30 for postal

charges. The details regarding the tender may be had

from this office on working hours.

ta∏mSn k¿°m¿ t]mfn-sS-Iv\n°v tImtf-Pnse

Iºyq-´¿

lm¿Uvsh-b¿ em_n-te-°v

Iºyq-´¿

lm¿Uv sh-b¿ D]-IcWßƒ hnX-cWw sNøp-∂-

Xnte°mbn ap{Z-h® Ih-dn¬ Z¿Lm-kp-Iƒ £Wn-®p

sImffp-∂p. Ih-dn-\p- ]p-dØv Z¿Lmkv \ºcpw

Xob-Xnbpw \n¿_-‘-ambpw kqNn-∏n-t°-≠-Xm-Wv.

Z¿Lm-kp-Iƒ kzoI-cn-°p-∂ -A-h-km-\- Xo-b-Xn-°Iw,

]qcn-∏n® Z¿-Lm-kp-Iƒ {]n≥kn-∏mƒ, k¿°m¿

t]mfn-sS-Iv\n°v tImtf-Pv, ta∏mSn F∂ hnem-kØn¬

e`n-t°-≠-Xm-Wv.

Gaz. No. 8/2009/DTP (Stores).

Z¿Lm-kp-Iƒ Bh-iy-ap≈ ÿm]-\-ßƒ°pw

hy‡nIƒ°pw Z¿Lmkv hne Hm^o-kn¬ AS®v

ssI∏-‰m-hp-∂-Xm-Wv. X]m¬ aptJ\ Z¿Lm-kp-Iƒ

Bh-iy-ap-≈-h¿ Z¿Lmkv hne-tbm-sSm∏w X]m¬ Nm¿÷v

30 cq] IqSn aWn-tbm¿U¿ Ab-®m¬ aS° X]m-en¬

Z¿-Lm-kp-Iƒ Ab-®p-X-cp-∂-Xm-Wv. Z¿-Lm-kn-t\m-sSm∏w

samØw Z¿-Lmkv kwJy-bpsS Hcp iX-am\w \nc-X-{Z-hy-

ambn ka-¿-∏n-t°-≠Xm-Wv. A]q¿Æhpw sshIn-°n-

´p∂Xpamb Z¿L-mkp-Iƒ kzoI-cn-°p-∂-X-√. Z¿Lm-kp-Iƒ

Xmsg kqNn-∏n® Xob-Xn-bn¬ {]n≥kn-∏m-fns‚ Hm^o-kn¬

h®v Xpd-°p-∂-Xm-bn-cn-°pw.

Z¿Lmkv Xob-Xn—19-˛1-˛2009

Z¿Lmkv t^mdw hn¬°p∂ Ah-km\ Xob-Xn-bpw

ka-bhpw —27-˛2-˛2009, 10 aWn.

Z¿Lmkv Xpd-°p∂ Xob-Xnbpw ka-b-hpw—27-˛2-˛2009,

3 aWn.

Sl.

Items

Current

No.

Requirements

Nos.

Intel DG31PR Motherboard

Intel Core 2 Duo E4600 2.53 Ghz

DDR II 2GB

HDD 160 GB SATA

DVD Writer 20x

ATX Cabinet with Front USB and

Audio

All in One Card reader Drive Type

Webcam Day and Night Model

Monitor 15" TFT

Speaker Stereo

Keyboard Logitech Normal USB

Mouse Logitech USB Optical Normal

Dotmatrix Printer 24 Pin in 136

Colum 300 cps with Colour

Vaccum cleaner

External DVD Writer (USB)

Government Polytechnic College,

(Sd.)

Meppadi, Wayanad.

Principal.

SHORT TENDER NOTICE

No. D1/2631/2008.

20th January 2009.

Sealed tenders are invited for the supply of certain

items for Transportation Engineering Lab of Government

Engineering College, Kannur.

Approximate Cost— Rs. 2,40,000,

E. M. D.—1% of quoted value.

The tender should be superscribed No. D1/2631/2008

addressed to the Principal, Government College of

Engineering, P. O. Parassinikadavu, Kannur-670 563. Last

date and time of receipt of tender is 1-3-2009 at 4 p. m. and

the tender will be opened at 11 a. m. on 2-3-2009 in the

presence of such of the tenderers or authorised

representatives who may be present at that time. Late

tenders will not be accepted.

Intending tenderers may on application to the

Principal, Government College of Engineering,

P. O. Parassinikadavu, Kannur-670 563 obtain the requisite

tender forms on which tenders should be submitted.

Application for the tender forms should be accompanied

by a cash remittance of Rs. 450 which is the price fixed for

a form/set of forms and which is not refundable under any

circumstances. The tender forms are not transferable.

Sale of tender forms will be closed at 3 p. m. on 1-3-2009.

Cheques, Postage Stamps, D. D., I. P. O. etc. will not

be accepted towards the cost of forms, nor will the forms

be sent by V. P. P. Duplicate forms, if required will be

issued at Rs. 225 per copy.

Those who want tender form by post should sent an

additional amount of Rs. 27 towards the postal charge.

hnX-cWw sNøp-∂-Xn\v ap{ZWw sNbvX Z¿-Lm-kp-Iƒ

£Wn-®psIm-≈p-∂p.

ap{ZWw sNbvX Z¿Lm-kp-Iƒ {]n≥kn-∏mƒ,

hnem-k-Øn¬ 1˛3-˛2009-˛\v sshIp-t∂cw 4 aWn°v apºmbn

e`n-t°-≠-Xm-Wv. \n›nX kabØn\pw Xob-Xn°paIw

e`n-°p∂ ap{ZWw sNbvX Z¿Lm-kp-Iƒ 2˛3-˛2009-˛\v

cmhnse 11 aWn°v lmP-cm-bn-´p≈ AwKo-IrX

{]Xn-\n--[n-I-fpsS km∂n-≤y-Øn¬ Xpd-°p-∂-Xm-Wv.

Z¿Lmkv t^md-ßƒ Bh-iy-ap≈ hy‡n-Iƒ/

tImtfPv, IÆq¿-˛670 563 F∂ hnem-k-Øn¬ 450 cq]

AS®v At]-£n-®m¬ Z¿Lmkv ^md-ßƒ e`n-°p-∂XmWv.

X\n-∏-I¿∏p-Iƒ Bh-iy-ap≈h¿ 225 cq] AS®v ssI∏-‰m-

hp-∂-Xm-Wv. Z¿Lmkv ^md-Øns‚ hne sN°v/Un. Un./

t]mtÃPv Ãmºv/sF. ]n. H. F∂nh aptJ\ AS-bv°m-hp-

∂-X-√. hn. ]n. ]n. A\p-h-Z-\o-b-a-√. Z¿Lmkv

^md-ßƒ 1˛3˛2009-˛\v D®bv°v 3 aWn-hsc ssI∏-‰m-hp-∂

-Xm-Wv.

Sl.

Items and Specification

Quantity

No.

Nos.

(1)

(2)

(3)

IS Sieve-size-125 mm

IS Sieve-size-90 mm

IS Sieve-size-75 mm

IS Sieve-size-53 mm

IS Sieve-size-45 mm

IS Sieve-size-37.5 mm

IS Sieve-size-26.5 mm

IS Sieve-size-19 mm

IS Sieve-size-13.2 mm

IS Sieve-size-9.5 mm

IS Sieve-size-3.35 mm

IS Sieve-size-2.8 mm

IS Sieve-size-1.18 mm

IS Sieve-size-1.14 mm

IS Sieve-size-0.850 mm

IS Sieve-size-0.710 mm

IS Sieve-size-0.600 mm

IS Sieve-size-0.425 mm

IS Sieve-size-0.355 mm

IS Sieve-size-0.300 mm

IS Sieve-size-0.212 mm

IS Sieve-size-0.180 mm

IS Sieve-size-0.150 mm

IS Sieve-size-0.090 mm

IS Sieve-size-0.075 mm

Sievesbaker with adapter

(Course and Fine)

Stop Watch

Tar Thermometer

Straight metal tamping red of circular

cross section 16 mm dia and 45 to

60 cm long, rounded at one end.

Laboratory Electric oven, thermostati-

cally, Controlled range 50 C to 250 C

with air circulating fan, stainless steel,

inside size 600 x 900 x 600 mm

All accessories of angularity number

experiment such as

(1) Metal cylinder closed at one end

and of about 3 lit. capacity, 15.64 cm

dia 15.6, 4 cm height

(2) Metal Scoop of about one bit.

heaped capacity of size 20 x 10 x 5

All the accessories of specific gravity

test such as

(1) A wire basket of not more than

6.3 mm mesh or a performed container

with thin wire hangers for suspen-

ding it from the balance.

(2) A container for filling water and

suspending the basket.

(3) An air tight container of capacity

similar to that of the basket [referre

to in (1)]

Electronic balance 20 kg. capacity and

accurate up to 1g. pan size 290 x 210.

Electronic balance 3 kg. capacity and

accurate up to 0.1 g. pan size 116 mm

dia.

Spatula 150 mm blade with wooden

handle

Heat resistance glove

Crucible tongs straight 200 mm long

Sample tray (enamel tray), size 6.50 ×

500 × 50 mm

Sample tray (enamel tray), size 450 ×

300 × 40 mm

Beaker (glass) graduated 100 ml size

Desicater non vaccum type, 200 mm

dia (glass)

Thermometer (range 0 to 250 C )

Filter papers-whatman filter

No. 40/41/42 dia. 110 mm (box of 100)

Extension chord box length of chord

5 m. containing 3 three pin plug

Marshalstability apparatus 50 KN

capacity with all accessories (proving

ring above 2.5 KN, Dial guage etc.)

Government Engineering College,

(Sd.)

Kannur.

Principal.

Department of Vocational Higher Secondary

Education

SHORT TENDER NOTICE

[1/2008-09]

No. 47/2009 (1).

27th January 2009.

Sealed and competitive tenders are invited from

reputed firms for the supply of equipments to Biology and

Agriculture Laboratories of G. V. H. S. S. Technical High

School, Palakkad.

Earned Money Depost—1% of the quoted value by

means of DD form the Nationalised Bank.

Cost of tender form :

Original—Rs. 450 + ST.

Duplicate—Rs. 225 + ST.

(1)

(2)

(3)

(1)

(2)

(3)

Last date and time of issue of tender form—

2-3-2009, 10 a. m.

Last date and time of receipt of tender form—

2-3-2009, 2 p. m.

Date and time of opening of tenders—2-3-2009, 3 p. m.

The tenders should be accompanied by an agreement

executed in the Kerala Stamp Paper worth Rs. 50.

The

tenders

without

tender

form,

agreement,

EMD will be rejected.

Intending tenderers may obtain the requisite non

transferable tender forms separately for each requirement

from the Principal, G.V.H.S.S./Technical High School,

Palakkad on payment of value noted above by cash or by

Money Order (Postage Rs. 50 Extra).

The cost of tender

forms will be accepted by means of cash or Money Order

only.

Tenders should be clearly superscribed.

The same

will be opened on the specific date and time in the

presence of such tenderers or their authorized

representatives.

Late tenders will not be considered.

k¿°m¿

hn.-F-®v.-F-kv.-F-kv./sSIv\n-°¬

sslkvIq-fnse _tbm-fPn, A{Kn-°ƒ®¿ em_v D]-I-c-W-

ßƒ hmßp-∂-Xn\v {]ikvX ÿm]-\-ß-fn¬ \n∂v

ap{Zh® sS≠-dp-Iƒ £Wn-®psIm≈p-∂p.

\nc-X-{Zhyw—XpI-bpsS Hcp iX-am\w.

Z¿Lmkv t^md-Øns‚ hne (\n-IpXn Dƒs∏-sS):

A ¬—cq] 450.

]I¿∏v—cq] 225.

Z¿Lmkv t^mdw hnX-cWw sNøp∂ Ah-km\

XobXnbpw ka-bhpw—2˛3˛2009, cmhnse 10 aWn.

Z¿LmkpIƒ kzoI-cn-°p∂ Ah-km\ Xob-Xnbpw

ka-bhpw—2˛3˛2009 2 aWn.

Z¿Lmkv Xpd-°p∂ Xob-Xnbpw ka-bhpw—2˛3˛2009

sshIpt∂cw 3 aWn.

50 cq]-bpsS tIcf k¿-°m¿ ap{Z-∏-{X-Øn¬

Xøm-dm-°n-bn-´p≈ kΩ-X-]{Xw Z¿Lm-kn-t\m-sSm∏w

ka¿∏n-t°-≠-Xm-Wv.

sshIn In´p∂ Z¿Lm-kp-Iƒ

]cn-K-Wn-°p-∂-X-√.

-Xmev]-cy-ap-≈-h¿°v ssIam‰w

sNøm-\m-hmØ Z¿Lm-kp-Iƒ Hmtcm-∂n\pw {]tXy-I-ambn

Hm^o-kn¬ ]W-a-S-®m¬ t\cnt´m aWn-tbm¿U¿ aptJ-\tbm

am{Xw e`n-°p-∂-Xm-Wv. (X-]m¬ Iqen 50 cq] {]tXy-Iw)

Z¿Lm-kp-Iƒ \n›nX ka-bØpw Xob-Xn-bnepw

XZ-h-k-c-Øn¬ km∂n-≤y-ap≈ Z¿Lm-kp-Im-cpsS ap∂n¬h®v

Xpd-°p-∂-Xm-Wv.

-\n-c-X-{Z-hyhpw kΩ-X-]-{Xhpw C√mØ

Z¿Lm-kp-Iƒ kzoI-cn-°p-∂-X-√.

V.H.S.S., Technical High School,

(Sd.)

Palakkad.

Principal.