Supplement

Kerala Gazette No. 8 dated 24th February 2009.

PART III

STORES PURCHASE

(1)

(2)

(3) Agriculture Department

ദർഘാസ് പരസ്യം

നമ്പർ എ.ഇ.(2) 578/2008. 2009 ജനുവരി 27.

കേരള ഗവർണ്ണർക്കുവേ≠ി കൊല്ലം കൃഷി അസിസ്റ്റന്റ ് എക്സിക്യൂട്ടീവ് എഞ്ചിനീയർ, കൊട്ടാരക്കര കശുമാവിൻ തോട്ടത്തിന് വേ≠ി താഴെ പറയുന്ന കാർഷിക ഉപകരണങ്ങൾ വാങ്ങുന്നതിന് അംഗീകൃത ഏജൻസികളിൽ നിന്നും മൽസര സ്വഭാവമുള്ള ദർഘാസുകൾ മുദ്രവച്ച കവറുകളിൽ ക്ഷണിച്ചുകൊള്ളുന്നു.

5 റോട്ടറി ടില്ലർ (2.1 എച്ച്.പി. 8000 ആർ.പി.എം. 1 എണ്ണം 21 കെ.ജി. പെട്രോൾ എൻജിൻ)

6 ഗ്രാഫ്റ്റിംഗ് കത്തി

20 ,, 7 സി-7, 2 സ്ട്രാക്ക് സ്പ്രേയർ 1 ,, 8 റോക്കർ സ്പ്രേയർ 4 ,, 9 നാപ്പ് സാക്ക് സ്പ്രേയർ 4 ,, 10 1 ഇഞ്ച് ഫ്ളെസ്ക് ഹോസ്

150 മീറ്റർ 11 1.5 ഇഞ്ച്

കവറിന്റെ പുറത്ത് 'കാർഷിക ഉപകരണങ്ങളുടെ വിതരണം' എന്ന് എഴുതിയിരിക്കേ≠താണ്. ദർഘാസുകൾ 28-2-2009 വൈകുന്നേരം 3 മണിവരെ ഈ ഓഫീസിൽ സ്വീകരിക്കുന്നതും അന്നേ ദിവസം വൈകുന്നേരം 3.30-ന് ഹാജരുള്ള കരാറുകാരുടേയോ അവർ രേഖാമൂലം അധികാരപ്പെടുത്തുന്ന ഏജന്റുമാരുടേയോ സാന്നിദ്ധ്യത്തിൽ തുറക്കുന്നതും ഏറ്റവും കുറഞ്ഞ നിരക്ക് രേഖപ്പെടുത്തിയ ആളിന്റെ പേരിൽ സ്ഥിരപ്പെടുത്തുന്നതുമാണ്.

ക്രമ ഇനം അളവ് നമ്പർ

(1)

(2)

(3) 1 3 എച്ച്.പി. പെട്രോൾ-മണ്ണെണ്ണ പോർട്ടബിൾ 1 എണ്ണം പമ്പ് സെറ്റും അനുബന്ധ സാമഗ്രികളും

2 മിനി മെതിയന്ത്രം 0.5 എച്ച്.പി. മോട്ടോർ 1 ,, സഹിതം

3 ഡിജിറ്റൽ മോയ്സ്ചർ മീറ്റർ, കംപ്യൂട്ടർ ഫിറ്റിംഗ് 1 ,, സഹിതം

4 ചെയിൻസാ 2.5 എച്ച്.പി., 4 കെ.ജി. 450 എം.എം. 1 ,, സ്പോക്കറ്റ് നോസ് ടൈപ്പ്

150 മീറ്റർ 12 വീൽബാരോ

2 എണ്ണം 13 പോർട്ടബിൾ ജനറേറ്റർ സെറ്റ് 1.5 കെ.വി.എ. 1 ,, നിരതദ്രവ്യം—2.5%.

ദർഘാസ് ഫോറത്തിന്റെ വില—രൂപ 600 + വാറ്റ്.

ദർഘാസുകൾ സ്ഥിരപ്പെടുത്തി കിട്ടുന്നയാൾ ഈ ആഫീസിൽ നിന്നും വിതരണ ഉത്തരവ് കിട്ടി 7 ദിവസത്തിനകം 50 രൂപ മുദ്രപ്പത്രത്തിൽ ആവശ്യമായ എഗ്രിമെന്റ ് സമർപ്പി ക്കേ≠താണ്. ക്വട്ടേഷനുകൾക്ക് സർക്കാർ നി›യിച്ചിട്ടുള്ള എല്ലാ മാനദണ്ഡങ്ങളും ഇതിനും ബാധകമായിരിക്കും.

കൃഷി അസിസ്റ്റന്റ ് എക്സിക്യൂട്ടീവ് (ഒപ്പ്) എഞ്ചിനീയറുടെ കാര്യാലയം, അസിസ്റ്റന്റ ് എക്സിക്യൂട്ടീവ് കൊല്ലം. എഞ്ചിനീയർ (കൃഷി).

Animal Husbandry Department

TENDER NOTICES

[12/2008-09]

(1)

No. G3-12826/2008/AHD.

15th January 2009.

Sealed and competitive tenders are invited under "Two cover system" for the supply of Veterinary Medicines (Common and Patent) for the use of Various Veterinary Institutions of Animal Husbandry Department for the year 2008-09.

First Cover (Cover A-Technical) will have the following enclosures :

1. List of Medicines intended to be quoted with specification and without rates.

2. GMP Certificate in accordance with (1) "Revised schedule M of Drugs and Cosmetics Rules 1945" (Current GMP) or (2) WHO GMP Certificate. Only these certificates will be accepted.

3. Certificate from Licensing Authority/Drugs Controller to prove minimum 3 years of market standing of the product.

Gaz. No. 8/2009/DTP (Stores).

4. Attested copy of license or certificate of renewal and the list of drugs. Tenderers should be original manufacturers of the quoted item. Items manufactured on loan license or purchased from other sources will not be accepted except for imported items.

5. Non-Conviction Certificate from the Drugs Controller.

6. Latest Annual Accounts of statement audited by a Chartered Accountant.

7. Sales Tax Clearance Certificate from concerned authorities.

8. Attested copy of Memorandum and articles of Association or partnership deed.

9 An affidavit in stamp paper worth Rs. 50 notorized by a Notary Public of either the place where the person making the affidavit is residing or of Thiruvananthapuram signed by the owner of the firm.

10 All documents furnished should be attested by a Gazetted Officer or Notary.

Second Cover (Cover B-Financial) will have the following enclosures :

1. Quoted rates for each drug (inclusive of Tax).

2. Original tender form duly signed by authorized signatory.

3. Preliminary agreement in Kerala Stamp Paper worth Rs. 50.

4. EMD (1% of the total cost of medicines quoted) by means of demand draft drawn in favour of Director of Animal Husbandry, Kerala payable at Thiruvananthapuram.

Both covers (A & B) must be effectively sealed and put in another cover, which is also sealed and submitted. Cover A and B will be opened as per the schedule given below. Cover 'B' of those tenderers who satisfy the above conditions in Cover 'A' will only be opened. The cover B of rejected tenders will be returned without opening on finalization of purchase procedure. Details of medicines to be supplied can be had from the tender form and Government of Kerala Website www.kerala.gov.in. Intending tenderers may send the exact amount towards the cost of tender form. Cheques, Postage Stamps, Postal Orders, Demand Drafts etc. will not be accepted as the cost of tender form nor the form be sent by Value Payable Post. Tender form can also be obtained from the Office of the Director of Animal Husbandry on payment of the cost in cash during Office hours. Late tenders will not be considered under any circumstances. Tenders should be superscribed as "Tender No. 12/2008-09 for the Supply of Veterinary Medicines (Common and Patent) for the use of the Animal Husbandry Department, Kerala for the Year 2008-09".

Price of tender form :

Original—Rs. 25,000 + VAT @ 12.5%.

Duplicate—Rs. 12,500 + VAT @ 12.5%.

Last date and time for sale of tender forms—25-2-2009, 4 p. m.

Due date and time for receipt of tenders (Cover A and B)—26-2-2009, 4 p. m.

Date and time for opening of Cover A—27-2-2009, 10.30 a. m.

Date and time of publishing list of tenderers eligible for opening their Cover B—27-2-2009, 1 p. m.

Date and time for opening of Cover B—27-2-2009, 2 p. m.

Date upto which the rates are to be firm for acceptance—31-3-2009.

Designation and address of the Officer from whom the tender forms are to be obtained and to whom the tenders are to be submitted—The Director, Animal Husbandry Department, Vikas Bhavan P. O., Box No. 5403, Thiruvananthapuram-695 033.

LIST OF MEDICINES

Common Drugs

1 Acid Benzoic

500 gm. Acid Benzoic I.P.-500 gm. 6000 2 Acid Boric

500 gm. Acid Boric I.P. 500 gm. 20500 3 Acid Salicylic

500 gm. Acid Salicylic I.P. 500 gm. 10000 4 Acriflavin

100 gm.

2000 5 Ammo. Carb

500 gm. Acid Salicylic I.P. 500 gm. 10000 6 Bismuth Carb

500 gm. Bismuth Carb I.P. 500 gm. 1000 7 Calcium Gluconate 500 gm. Calcium Gluconate I.P. 500 gm. 400 8 Copper Sulphate 500 gm. Copper Sulphate 500 gm. 2000 9 Creta preparata 1 kg.

40000 10 Formalin

500 ml. Formalin B.P. 500 ml. 7000 11 Glycerine

500 ml. Glycerine I.P. 500 ml. 12000 12 Light Kaolin

1 kg. Light Kaolin I.P. 1 kg. 30000 13 Light Liquid Paraffin 500 ml. Light Liquid Paraffin I.P. 500 ml. 5000 14 Lint. Camphor

500 ml.

5000 15 Lint. Turpentine 500 ml. Lint. Turpentine 500 ml. 3056 16 Mag. Sulph

25 kg. Mag. Sulph 25 kg. 1000 17 Mag. Carb.

500 ml. Mag. Carb. 500 gm. 15000 18 Oil Turpentine 500 ml. Oil Turpentine 500 ml. 15000 19 Ol. Piscis Liquidum 500 ml.

10000 20 Paraffin mole album 5 kg.

16 21 Phenyl Lotion Gr. III 5 lit.

7000 22 Piperazine Hexahydrate Liquid 45% 500 ml.

6000 23 Potassium Permanganate 500 gm. Potassium Permanganate I.P. 500 gm. 80000 24 Pulv. Ajown

2 kg. Pulv. Ajown 2 kg. 10000 25 Pulv. Chiretta

2 kg. Pulv. Chiretta 2 kg. 7000 26 Pulv. Zingiberris 2 kg. Pulv. Zingiberris 2 kg. 10000 27 Soda salicylate 500 gm. Sodium salicylate I.P. 500 gm. 20000 28 Sodabicarb

1 kg. Sodabicarb I.P. 1 kg. 25000 29 Sulphur sublimatum 500 ml. Sublimed Sulphur 500 gm. 15000 30 Tr. Asafoetida

500 ml. Tr. Asafoetida 500 ml. 15000 31 Tr. Benzoin

500 ml. Compund Benzoin Tincture I.P. 500ml. 6053 32 Tr. Cardamom 500 ml. Tr. Cardamom B.P. 500 ml. 15000 33 Tr. Catechu

500 ml. Tr. Catechu B.P. Vet 500 ml. 15000 34 Tr. Gentian

500 ml. Tr. Gentian B.P. 500 ml. 15000 35 Tr. Iodine

500 ml.

16000 36 Tr. Opium 500 ml. Tr. Opium B.P. 500 m. 35 37 Zinc Oxide

500 gm. Zinc Oxide I.P. 500 gm. 60534

Patent Drugs

1 Adrenaline inj. 1 ml. Each ml. contains Adrenaline acid tartarate 180 mcg/ 30

0.1 ml. equivalent to 1:1000 adrenaline

2 Adrenochrome inj. 10 ml. Adrenochrome 10 ml. injection each ml. containing 4000

Carbasochrome salicylate equivalent to Adrenochrome monosemicarbazone 10 mg, benzyl alcohol I.P. (as preservative) 2.5% w/v

3 Albendazole 300 mg + Praziquintal Albendazole 300 mg + Praziquintal 25 mg. tablet each 200000 25 mg. tablet

tablet containing 300 mg. Albendazole and Praziquintal 25 mg.

4 Albendazole bolus 600 mg. Albendazole 600 mg. bolus each bolus containing 1900

Albendazole 600 mg.

5 Albendazole Bolus 1.5 gm. Albendazole 1.5 gm. bolus each bolus containing 1500

Albendazole 1.5 gm.

6 Albendazole Suspension 2.5% 1 litre Albendazole 1 litre suspension containing Albendazole 3000

2.5 % W/V.

7 Amikacin inj. 250 mg/2ml. 2 ml. Each vial containing Amikacin sulphate 250 mg. I.P. 29000 8 Amitraz Liq 250 ml. Amitraz 250 ml. Liquid each ml. containing 50 mg. 10000

Amitraz B.P. W/V.

9 Amoxycillin cloxacillin inj. 500 mg. Each vial containing Amoxicillin Sodium 250 mg. and 29000

Cloxacillin 250 gm. I.P.

10 Amoxycillin cloxacillin inj. 3 gm. Each vial containing Amoxicillin Sodium 1.5 gm. and 650

Cloxacillin sodium 1.5 gm.

11 Amprolium 100 gm. Amprolium hydrochloride + Vit K 500 gm. powder 1375

containing Amprolium hydrochloride I.P. 20% w/w, Vit K I.P. 2% w/w

12 Antimony Potassium Tartarate + Antimony Potassium Tartarate + Ferrous Sulph + Copper 900 Ferrous Sulph + Copper Sulph + Sulph + Cobaltus Chlor Bolus Each bolus containing Cobaltus Chlor Bolus Antimony Potassium Tartrate 2 gm. Ferrous Sulphate 2 gm. Copper sulphate 50 mg. and cobalt chloride 100 mg.

13 Atropine Sulphate inj. 1 ml. Atropine Sulphate 1 ml. injection each ml. containing 10000

1mg. of atropine sulphate I.P.

14 B1 + B6 + B12 Inj. 3 ml/10ml.

40000 15 Betamethasone inj. 2 ml. Betamethasone 2ml. injection each ml. containing 50000

Betamethasone Sodium Phopshate I.P. equivalent to Betamethasone 4 mg.

16 Calcium Boro Gluconate inj. 450 ml. Calcium Boro Gluconate 450 ml. injection containing 50000

Calcium Boro Gluconate 25% w/v B.P.

17 Calcium Mangnesium Boro 450 ml. Calcium Mangnesium Boro Gluconate 450 ml. injection 15 Gluconate inj.

containing Calcium Gluconate 20.75% w/v, Boric acid 4.2% w/v, Mangnesium hypophosphate 5.5 w/v, Dextrose unhydrous 20% w/v

18 Chloromphenicol sod. succinate inj. 1 gm. Chloromphenicol sod. succinate 1 gm. injection each vial 59000

contains Chloramphenicol Sodium Succinate I.P. equivalent to 1 gm. of Chloramphenicol

19 Chlorpheneramine maleate Inj. 30 ml. Chloraphenramine Maleate 30 ml. Injection each ml. 10000

contains 10 mg. of Phenramine maleate I.P.

20 Cypermethrin solution 1 litre Cypermethrin solution containing cypermethrin 2000

100 mg/ml.

21 Dexamethsone inj. 10 ml. Dexamethsone 10 ml. injection each ml. containing 130

Dexamethsone sodium phopshate I.P. equivalent to Dexamethsone 4 mg.

22 Dextrose inj. 25% 540 ml. Dextrose 25% 540 ml. injection containing Dextrose 50000

I.P. 25% w/v

23 Dextrose inj. 10% 540 ml. Dextrose 10% 540 ml. injection containing Dextrose 370

I.P. 10% w/v

24 Dextrose Normal Saline inj. 540 ml. Dextrose Normal Saline 540 ml. injection containing 100000

0.9 % w/v sodium chloride and 5% w/v Dextrose 25 Diaminazene Aceturate 5 gm. Granules containing 4, 4 Diamidino diazoamin- 7000

nobenzenediacceturate in amber coloured bottle 26 Distilled water 10 ml. vial

80000

(plastic vials)

27 Doxycycline + Neomycin powder 100 gm. Each gm. containing Doxycycline hydrochloride I.P. 7000 (100 mg + 100 mg.)

100 mg. and Neomycin sulphate I.P. 100 mg.

28 Enrofloxacin 10% inj. 30 ml. Enrofloxacin 10% 30 ml. injection each ml. containing 90000

enrofloxacin 100 mg.

29 Enrofloxacin 10% Oral liquid 1 litre Enrofloxacin 10% 1 litre Oral solution each ml. contains 1000

enrofloxacin 100 mg./ml.

30 Fenbendazole bolus 150 mg. Fenbendazole 150 mg. bolus each tab should contain 350000

150 mg. of Fenbendazole

31 Gamma BHC + Proflavin spray Gamma BHC + Proflavin Cetrimide 100 gm. ointment 355

Containing 0.1% of pure Gamma isomer of benzene

hexachloride, 0.1% Proflavin hemisulphate and 0.45%

Cetrimide I.P.

32 Gentamycin 40 mg/ml inj. 30 ml. Gentamycin 30 ml. injection each ml. contains 90000

Gentamycin 40 mg. as gentamycin sulphate I.P. 33 Gn RH Inj. 10 ml. Gn RH inj. each ml. containg Brusalin acetate 0.0042 20000

equivalent to Brusalin 0.004 mg.

34 Iodine methyl salicytae ointment 500 gm. containing Iodine 4% w/w & methyp salicylate 10000

5% w/v

35 Ivermectin Inj. 7 ml. Ivermectin 7 ml. Injection containing Ivermectin 10000

1% w/v

36 Lignocaine inj. 30 ml. Lignocaine 30 ml. Injection containing Lignocaine 7000

HCL I.P. 2%

37 Meloxicam Inj. 30 ml. Meloxicam 30 ml. injection each ml. containing 40000

meloxicam BP 5 mg.

38 Metronidazole inj. 100 ml. Metronidazole 100 ml. injection each ml. contains 30000

Metronidazole I. P. 5 mg

39 Nitrofurazone, Metranidazole + Urea Nitrofurazone, Metranidazole + Urea Pessary 375 40 Obstetrical cream 500 gm.

10000 41 Oxy Tetracycline DS inj. 30 ml. Oxy Tetracycline DS 30 ml. injection each ml. containing 48000

Oxytetra cycline hydrochloride I.P. 100 mg.

42 Oxytocin inj. 1 ml. Each 0.5 ml. containing 5 units of Oxytocin I. P. 10000 43 Piperazine Hexahydrate Liquid 45% 500 ml. Containing Piperazine Hexahydrate 45% w/v 330 44 Prednisolone 10 mg./ml. inj. 10 ml. Prednisolone 10 ml. Injection each ml. containing 10 mg. 30

of Prednisolone

45 Pyrantel Palmoate 10 ml. Pyrantel Pamoate 10 ml. liquid Each ml. containing 50 mg. 60000

Pyrantel pamoate

Gaz. No. 8/2009/DTP (Stores).

46 Strepto Pencillin inj. 2.5 gm. Strepto Pencillin inj. 2.5 gm. should contain Sreptomycin 70000

sulphate 2.5 gm. Procaine pencillin 15 lakhs unit & Pencillin G Sodium 5 lakh unit

47 Xylazine HCL inj. 5 ml. Xylazine HCI 5 ml. injection each ml. containing 10000

Xylazine Hyrochloride B. P. 23.332 mg. equivalent to 20 mg. of Xylazine

SPECIAL CONDITIONS

1. The medicine should be of latest standards and should have minimum 75% shelf life left under normal storage condition at the time of supply.

2. The rates quoted should be inclusive of all taxes.

3. All offers should be from ready stock in the oringinal packing of the manufacturer.

4. The samples of all items supplied after effecting supply will be get tested through Drug Controller, Thiruvananthapuram. The supplier should bear the expenditure for testing of the drugs.

5. 75% of payment will be effected at an early date from the date of acceptance of the consignment by the Departmental stores subject to the availability of funds and priority of supplies. The balance 25% of payment will be released only after getting the test results.

6. Packing and containers of drugs shall be as prescribed in Pharmacopeias or Drugs and Cosmetic Rules 1945. Containers made of good plastic must be used for those items which are to be supplied in plastic containers.

7. The Security Deposit furnished will be released only after satisfactory completion of the contract.

8. The rates should be for delivery F.O.R. at any part of the State.

9. Ex-godown rates and F.O.R. station of despatch rates offered by the firms are not acceptable and such tenders will be summarily rejected.

10. On the label of each packing it should be inscribed "For the use of Animal Husbandry Department, Kerala".

11. The quantities specified in the schedule are only approximate and they may vary according to actual need.

12. Successful tenderers should supply the items at the approved rates and conditions to the local self Governments and other Departmental Institutions as per their request.

13. The successful tenderers should complete all supplies with in the stipulated time stated in the supply orders.

14. The non-availabilty of raw materials, price hike of raw materials, transporation problems etc. will not be accepted as reasons for non-supply or late supply.

15. The rates should be quoted in Indian Currency and payment will be made in Indian Currency only.

16. The successful tenderers should produce analytical report of every batch of medicine they have supplied, to the Controlling Officer of the destination, at the time of the supply and send a copy to the Director of Animal Husbandry.

17. The Director of Animal Husbandry reserves all rights to cancel the tender without assigning any reason thereof.

18. The Director of Animal Husbandry on his authority has the right to inspect the manufacturing unit.

19. The only jurisdiction for any dispute regarding this purchase will be at Thiruvananthapuram.

20. The photocopies of the documents produced along with the tender should be attested by a Gazetted Officer or a Notary.

21. If any of the date scheduled for receipt and opening of tender is declared as holiday, (local or general), the receipt and opening will be on the next working day at the same time.

22. Name and place to which the medicines are to be supplied :

Three Central Veterinary Stores at Thiruvananthapuram, Thrissur and Kozhikode however the tenderer should be ready to be supplied to any part of the State.

23. The Director of Animal Husbandry reserves the right to delete, waive any of the above special conditions or cancel the whole tender.

24. The Supply should be effected only by the original tenderer and the invoice should also be furnished only by them.

(2)

[25/2008-09]

Second Cover (Cover B-financial) will have the following

No. G3-17326/08/AHD. 17th January 2009.

enclosures:

Sealed and competitive tenders are invited under "Two cover system" for the supply of 2,00,000 doses (20,000 x 10 ml.) of Tissue Culture Anti-rabies Vaccine for the use of Various Veterinary Institutions of Animal Husbandry Department for the year 2008-09.

1. Quoted rates of the vaccine (Inclusive of Tax).

2. Original tender form duly signed by authorized signatory.

3. Preliminary agreement in Kerala Stamp Paper worth Rs. 50.

First Cover (Cover A-Technical) will have the following

enclosures:

1. Details of vaccine intended to be quoted with specification and without rates.

2. GMP Certificate in accordance with (1) "Revised Schedule M of Drugs and Cosmetics Rules 1945" (Current GMP) or (2) WHO GMP Certificate. Only these certificates will be accepted.

3. Certificate from Licensing Authority/Drugs Controller to prove minimum 3 years of market standing of the product.

4. Attested copy of licence or certificate of renewal and the list of drugs. Tenderers should be original manufacturers of the quoted item. Items manufactured on loan licence or purchased from other sources will not be accepted except for imported items.

5. Non-Conviction Certificate from the Drugs Controller.

6. Latest Annual Accounts of statement audited by a Chartered Accountant.

7. Sales Tax Clearance certificate from concerned authorities.

8. Attested copy of Memorandum and articles of Association or partnership deed.

9. An affidavit in stamp paper worth Rs. 50 notorized by a Notary Public of either the place where the person making the affidavit is residing or of Thiruvananthapuram signed by the owner of the firm.

10. All documents furnished should be attested by a Gazetted Officer or Notary.

4. EMD (1% of the total cost of medicines quoted) by means of demand draft drawn in favour of Director of Animal Husbandry, Kerala, payable at Thiruvananthapuram.

Price of tender form :

Original—Rs. 3,000 + VAT @ 12.5%.

Duplicate—Rs. 1,500 + VAT @ 12.5%.

Last date and time for sale of tender forms—

26-2-2009, 4 p. m.

Due date and time for receipt of tenders (Cover A and B)—27-2-2009, 4 p. m.

Date and time for opening of Cover A—28-2-2009, 10.30 a. m.

Date and time of publishing list of tenderers eligible for opening their Cover B—28-2-2009, 1 p. m.

Date and time for opening of Cover B—28-2-2009, 2 p. m.

Date upto which the rates are to be firm for acceptance—31-3-2009.

Designation and address of the Officer from whom the tender forms are to be obtained and to whom the tenders are to be submitted—The Director, Animal Husbandry Department, Vikas Bhavan, P. O. Box No. 5403, Thiruvananthapuram-695 033.

Both covers (A & B) must be effectively sealed and put in another cover, which is also sealed and submitted. Cover A and B will be opened as above. Cover 'B' of those tenderers who satisfy the above conditions in Cover 'A' will only be opened. The cover B of rejected tenders will be returned without opening on finalization of purchase procedure. Details of vaccine to be supplied can be had from the tender form and Government of Kerala Website-www.kerala.gov.in. Intending tenderers may send8 the exact amount towards the cost of tender form. Cheques, Postage Stamps, Postal Orders, Demand Drafts etc. will not be accepted as the cost of tender form nor the form be sent by Value Payable Post. Tender form can also be obtained from the Office of the Director of Animal Husbandry on payment of the cost in cash during office hours. Late tenders will not be considered under any circumstances. Tenders should be superscribed as "Tender No. 25/2008-09 for the Supply of Tissue Culture Anti-Rabies Vaccine for the use of the Animal Husbandry Department, Kerala for the Year 2008-09".

SPECIAL CONDITIONS

1. The vaccine should be of latest standards and should have minimum 75% shelf life left under normal storage condition at the time of supply.

2. The rates quoted should be inclusive of all taxes.

3. All offers should be from ready stock in the oringinal packing of the manufacturer.

4. Packing and containers of drugs shall be as prescribed in pharmacopeias or Drugs and Cosmetics Rules 1945. Containers made of good plastics must be used for those items which are to be supplied in plastic containers.

5. The Security Deposit furnished will be released only after satisfactory completion of the contract.

6. The rates should be for delivery F.O.R. at any part of the State.

7. Ex-godown rates and F.O.R. station of despatch rates offered by the firms are not acceptable and such tenders will be summarily rejected.

8. On the label of each packing it should be inscribed "For the use of Animal Husbandry Department, Kerala".

9. The quantities specified in the schedule are only approximate and they may vary according to actual need.

10. Successful tenderers should supply the items at the approved rates and conditions to the Local Self Governments and other Departmental Institutions as per their request.

11. The successful tenderers should complete all supplies with in the stipulated time stated in the supply orders.

12. The non-availabilty of raw materials, price hike of raw materials, transportion problems etc. will not be accepted as reasons for non- supply or late supply.

13. The rates should be quoted in Indian Currency and payment will be made in Indian Currency only.

14. The successful tenderers should produce analytical report of every batch of vaccine they have supplied, to the Controlling Officer of the destination, at the time of the supply and send a copy to the Director of Animal Husbandry.

15. The Director of Animal Husbandry reserves all rights to cancel the tender without assigning any reason thereof.

16. The Director of Animal Husbandry on his authority has the right to inspect the manufacturing unit.

17. The only jurisdiction for any dispute regarding this purchase will be at Thiruvananthapuram.

18. The photocopies of the documents produced along with the tender should be attested by a Gazetted Officer or a Notary.

19. If any of the dates scheduled for receipt and opening of tenders is declared as holiday (local or general), the receipt and opening will be on the next working day at the same time.

20. Name and place to which the vaccine is to be supplied:

Three Central Veterinary Stores at Thiruvananthapuram, Thrissur and Kozhikode however the tenderer should be ready to be supplied to any part of the State.

21. The Director of Animal Husbandry reserves the right to delete, waive any of the above special conditions or cancel the whole tender.

22. The Supply should be effected only by the original tenderer and the invoice should also be furnished only by them.

23. Sample should be furnished along with tender.

(3)

[26/2008-09]

No. G1-2785/08/St. 30th January 2009.

Sealed and competitive tenders are invited from the manufacturers/authorised suppliers for the supply of Ultra Sound Scanner for the use of District Veterinary Centre, Thiruvananthapuram for the year 2008-09.

1. Specification of the item with rate and list of institutions where it has been supplied and installed.

2. Letter from original manufacturer (in case of agents) regarding assurance about supply of spare parts, AMC conditions ( Period of visits in a year etc.), warranty conditions, years of warranty, brochures etc. 3. An affidavit in stamp paper worth Rs. 50 notarized by a Notary Public of either the place where the person making the affidavit is residing or of Thiruvananthapuram.

4. Copy of ISO Certification, if any.

5. Original tender form duly signed by authorized signatory.

6. Preliminary agreement in Kerala Stamp Paper worth Rs. 50.

7. EMD 1% of the total cost of items quoted by means of demand draft drawn in favour of Director of Animal Husbandry, Kerala, payable at Thiruvananthapuram.

Details of equipment to be supplied can be had along with the tender form, Government of Kerala Website- www.kerala.gov.in and the Department Website- ahdkerala.gov.in. Intending tenderers may send the exact amount towards the cost of tender form. Cheques, Postage Stamps, Postal Orders, Demand Drafts etc. will not be accepted as the cost of tender form nor the form be sent by Value Payable Post. Tender form can be obtained from the Office of the Director of Animal Husbandry on payment of the cost in cash during office hours. Late tenders will not be considered under any circumstances. Tenders should be superscribed as "Tender No. 26/2008-09 for the Supply of Ultra Sound Scanner for the use of District Veterinary Centre, Trivandrum, for the Year 2008-09".

Price of tender form :

Original—Rs. 2,300 + VAT @ 12.5%.

Duplicate—Rs. 1,200 + VAT @ 12.5%.

Last date and time for sale of tender forms—

2-3-2009, 4 p. m.

Due date and time for receipt of tender—3-3-2009, 11 a. m.

Date and time for opening of tender—3-3-2009, 4 p.m. Date upto which the rates are to be firm for acceptance—31-3-2009.

Designation and address of the Officer from whom the tender forms are to be obtained and to whom the tenders are to be submitted—The Director, Animal Husbandry Department, Vikas Bhavan, P. O. Box No. 5403, Thiruvananthapuram-695 033.

SPECIFICATION

Dedicated Veterinary High Performance, Premium, Professional, Efficient, Ergonomic Colordoppler Ultrasound Diagnostic System with

High Resolution 15" CRT monitor

Pulse Wave Doppler

HPRF

Color Doppler Flow Imaging

Regional Acoustic Zoom

Power Doppler Flow Imaging

Directional Power Doppler Flow Imaging

Tissue harmonic Imaging

Trapezoidal Imaging

Gaz. No. 8/2009/DTP (Stores).

i Touch TM automatic image optimization

80GB hard disk

CD-R/W and USB ports

Measurement & calculation software packages (Veterinary)

User- define key board

Standard 3 probe connectivity

Non windows based OS

AVI/CIN format cine, M/PW cine save, editable cine Total power consumption should be less than 1 Kva. Convex array transducer (2.5/3.5/5.0/H4.6/H6.0MHZ) Transrectal (side firing) transducer (5.0/6.5/8.0MHz) Ups with a backup of 30 min.

CONDITIONS

1. Offers should be from the manufacturers/suppliers of the items quoted and with original specifications, make models etc.

2. All successful tenderers should complete all the supplies within the stipulated time as mentioned in the supply order. No extension of time will be granted beyond this under any.

3. The leaflets, illustrated catalogue if any of the equipment/instrument quoted shall be sent along with the tender.

4. Equipments supplied should have a minimum warranty period of 1 year.

5. The prices quoted should be inclusive of all taxes, duties, cesses etc.

6. The rates should be quoted in Indian currency for the units specified against the items and the payment will be made in Indian currency only.

7. Offers of conditional supply to the department will not be considered.

8. The rates should be for delivery at the District Veterinary Centre, Thiruvananthapuram.

9. Ex-godown rates and F.O.R. station of despatch rates offered by the firms are not accepted and such tenders will be summarily rejected.

10. The quantities specified in the schedule are only approximate. The actual quantity to be delivered to the destinations will be intimated while placing supply orders.

11. Payment will be effected only after giving training by skilled personels, ascertaining the quality & working condition of the items supplied, subject to the availability of funds and priority of supplies.

12. The security deposit furnished by the firms will be released only after the warranty period.

13. The only jurisdiction for any disputes regarding this purchase will be at Thiruvananthapuram.

14. All the documents produced by the tenderers should be attested by a Gazetted officer.

15. The Director reserves all rights to delete any item from the tender without assigning any reason thereof.

16. The Director reserves all rights to waive any of the above mentioned conditions.

17. If the date scheduled for sale/receipt/opening of tender is declared as holiday (general/local), the schedule will be shifted to the next working day correspondingly.

18. Advance payment is not possible and, offer of those tenderers who insist for advance payment will not be accepted.

19. Name and place to which the articles are to be supplied—The District Veterinary Centre, PMG Jn., Thiruvananthapuram.

(Sd.) Office of the Director of Animal Husbandry, Vikas Bhavan, Thiruvananthapuram. Director.

TENDER NOTICE

[V/2008-09]

No. 961C/2007. 2nd February 2009.

Sealed competitive tenders are invited from approved manufacturers or authorized distributors/dealers for supply of the following reagents/items (70 Nos.) for the use of Molecular Biology Lab, Avian Disease Diagnostic Laboratory, Thiruvalla as detailed below.

Total Amount—Rs. 3,50,000.

തിരുവല്ലാ പക്ഷിരോഗ നിർണ്ണയശാലയിൽ മോളിക്കുലർ ബയോളജി ലബോറട്ടറി ഉപയോഗത്തിലേക്കായി താഴെ പറയുന്ന റിയേജന്റുകളും/വസ്തുക്കളും (70 എണ്ണം) വിതരണം ചെയ്യുവാൻ താൽപ്പര്യമുള്ള നിർമ്മാണ സ്ഥാപനങ്ങൾ/അംഗീകൃത വിതരണക്കാർ എന്നിവരിൽ നിന്നും മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചകൊള്ളുുന്നു.

അടങ്കൽ തുക— 3,50,000 രൂപ.

നിരതദ്രവ്യം— ആകെ തുകയുടെ 1%.

ദർഘാസ് ഫോറത്തിന്റെ വില :

അസ്സൽ— രൂപ 700 +12.5 % മൂല്യവർദ്ധിത നികുതി. പകർപ്പ്—രൂപ 400 +12.5 % മൂല്യവർദ്ധിത നികുതി. ദർഘാസ് ഫോറം നൽകുന്ന അവസാന തീയതിയും സമയവും—24-2-2009, വൈകിട്ട് 3 മണി വരെ.

ദർഘാസ് ഫോറം സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—25-2-2009 വൈകിട്ട് 4 മണി വരെ.

ദർഘാസ് തുറന്ന് പരിശോധിക്കുന്ന തീയതിയും സമയവും—26-2-2009 രാവിലെ 11 മണി.

ദർഘാസ് ഫോറം നൽകുകയും സ്വീകരിക്കുകയും ചെയ്യുന്ന ഓഫീസിന്റെ വിലാസം—പക്ഷിരോഗ നിർണ്ണയശാല, മഞ്ഞാടി പി. ഒ., തിരുവല്ലാ, പത്തനംതിട്ട ജില്ല, കേരളം, പിൻ-689 105.

കേരള സർക്കാർ ദർഘാസുകൾക്ക് ബാധകമാകുന്ന എല്ലാ നിയമങ്ങളും ഈ ദർഘാസിനും ബാധകമാണ്. റിയേജന്റു കളുടെയു വസ്തുക്കളുടെയും എല്ലാ വിവരങ്ങളും ദർഘാസ് ഫോറത്തിനൊപ്പം ലഭ്യമാണ്. ഈ ദർഘാസിന്റെ കാലാവധി ഈ ദർഘാസ് പരസ്യപ്പെടുത്തിയ തീയതി മുതൽ 6 മാസത്തേ ക്കായിരിക്കുന്നതാണ്.

LIST OF ITEMS

Sl. Name of Reagents/Consumables/ Quantity

No. Items

Earnest Money Deposit—1 % of the total quoted amount.

Cost of tender form :

Original—Rs. 700 + 12.5 % VAT.

Duplicate—Rs. 400 + 12.5 % VAT.

Last date and time of issue of tender form—

24-2-2009, 3 p. m.

Last date and time of receiving tender—

25-2-2009, 4 p. m.

Date and time of opening of tender—

26-2-2009, 11 a. m.

Address of Office from which tender forms are available and tenders are received—Avain Disease Diagnostic Laboratory, Manjadi P. O., Thiruvalla, Pin- 689 105, Pathanamthitta (Dist.), Kerala.

All Kerala Government orders and laws applicable to tenders are applicable to this tender also. Full details of the above item will be available along with tender forms. The validity of this tender will be for 6 months from the date of this tender notification.

(1) (2)

(3) 1 Bam HI, 4000 units 1 No. 2 Eco RI, 5000 units 1 ,, 3 Hind III, 5000 units 1 ,, 4 Sal I, 1500 units 1 ,, 5 Viral RNA isolation Kit (50 isolations) 1 ,, 6 Blood & Tissue DNA isolation Kit

(50 isolations)

1 ,, 7 First Strand cDNA Synthesis Kit

(100 reactions)

1 ,, 8 Proteinase K (1 ml) 3 Nos. 9 Taq DNA Polymerase (recombinant),

500 units

3 ,, 10 10 X Taq Buffer with KCI and

15mM MgC12 (5×1 ml set) 4 ,, 11 10 X Taq Buffers with KCI set (6×1 ml) 1 No. 12 25mM MgC12 (5×1 ml set) 1 ,, 13 Ribonuclease A (RNase A),

DNase-free, 10 mg 1 ,, 14 Nuclease-free water (5×1 ml set) 4 Nos.

15 dNTP Mix, 10mM (1 ml) 2 ,,11 (1) (2)

16 M-MuLV Reverse Transcriptase,

1000 units

1 No. 17 H Minus M-MuLV Reverse

Transcriptase 10000 units 1 ,, 18 Oligo (dT) 18 Primer, 120 μl 1 ,, 19 Random Hexamer Primer, 120 μl 2 Nos.

(3) (1) (2)

(3) 54 2.0 ml EPPENDORF tubes 1000Pcs/Pack 1 Pack 55 1.5 ml microcentrifuge tubes,

1000pcs/Pack 1 No. 56 Tag stickers rectangular, 1.28×0.5"

Yellow color, 1000 1 Roll Custom Oligonucleotides (Primers) required at an 20 RNase Inhibitor, 2500 units 2 ,, OD level of 3.0 (50n moles)

21 100bp DNA Ladder Plus, 50 μlg 3 ,, 22 1kb DNA Ladder, 5×50 μg 1 No. 23 6X Loading Dye Solution (5×1 ml set) 2 Nos.

24 10X TBE Electrophoresis Buffer (1 Litre) 1 No. 25 2X RNA Loading Dye Solution (1 ml) 1 ,, 26 DEPC-treated Water (5×1 ml set) 2 Nos.

27 Ethidium bromide, ready to use 10ml 1 No. 28 Agarose, Low EEO, 100g 1 ,, 29 Diethyl Pyrocarbonate, 25g 1 ,, 30 Boric Acid

(Molecular biology grade), 500g 1 ,, 31 EDTA (Molecular biology grade), 500g 1 ,, 32 EDTA 0.5 M Sterile Solution,

RNase-Free, 100ml 1 ,, 33 Ethanol

(Molecular biology grade), 500ml 3 Nos. 34 PBS Tablets-100ml, 100 Tablets 1 No. 35 Phenol: Chloroform (PH 6. 7/8.0) 500ml 1 ,, 36 Phenol: Chloroform: lsoamyl

alcohol 100ml 1 ,, 37 Chloroform: Isoamyl alcohol,

24: 1, 500mL 1 ,, 38 Sodium Acetate,

(Molecular biology grade), 500g 1 ,, 39 Sodium Bicarbonate A. R., 500g 2 Nos. 40 Sodium Chloride A. R., 500g 2 ,, 41 Sodium dodecyl sulphate (SDS), 100g 1 No. 42 Tris base, 500g. 2 Nos. 43 TE buffer, (PH 8.0), 100ml 1 ,, 44 Isopropyl alcohol, 1 litre 1 ,, 45 Disodium citrate 500g 1 ,, 46 Phenol-Guanidium Isothiocyanate

Reagent for RNA isolation, 100ml 2 Nos.

47 Carboy with Spigot, LDPE,

Volume 10 litres. 1 No. 48 0.2 ml PCR tubes, 1,000 pcs/pack,

transparent with caps 1 Pack 49 Microcentrifuge tube storage

Boxes. (96 places) 6 Nos.

50 Microcentrifuge tube storage

Racks. (96 places) 6 ,, 51 Lab top cooler (for-20ºc storage) 1 No. 52 Parafilm roll (4"×125") 1 ,, 53 Nitrile Powder free gloves,

medium size (100 Pcs/Pack) 5 Packs 57 IBSIF 5'-GCTCTAGAATGTTGGTAA 1 tube CACCTCTT-3'

each IBSIR 5'-GGGATCCTTAATAACTAA

CATAAGGGCA-3'

58 IBDF 5'-GCATGCGGTATGTGAG ,, GCTTGGTGAC-3'

IBDR 5'-GAATTCGATCCTGTTG

CCACTCTTTC-3'

59 MDF 5'-TACTTCCTATATAGA TT ,, GAGACGT-3'

MDR 5'-GAGATCCTCGTAAGGT ,, GTAATATA-3'

60 NDFF 5'-GCAGCTGCAGGGATTGTGGT-3' ,, NDFR 5'-TCTTTGAGCAGGAGGAT GTTG-3' 61 DPVF 5'-GAAGGCGGGTATGTAATGTA-3' ,, DPVR 5'-CAAGGCTCTATTCGGTAATG-3' 62 MGF:5'—GAGCTAATCTGTAAAGTTGGTC-3' ,, MGR:5'—GCTTCCTTGCGGTTAGCAAC-3' 63 BAF 5'—TCCTAACACTAACGAAGTCG-3' ,, BAR 5'—GAGGTAGAAGGATATACGGT-3' 64 PMF 5'—TGCCAAAATCGCAGTCAG-3' ,, PMR5'—TTGCCATCATTGTCAGTG-3'

65 FMDF 5'—GCCTGGTCTTTCCAGGTCT-3' ,, FMDR 5'—CCAGTCCCCTTCTCAGATC-3' 66 SFVF 5'—ATTGGCTCCATGCGGCTAGCCT ,, GCAAGGAAGATTAC-3'

SFVR 5'—CCCGGGAATTCCATGAA

ACAGCAGTAGTATCCATTTCTT-3' 67 cIL—2F 5'—ATGATGTGCAAAGTA

CTGATCTTTGGCTGT-3' ,, cIL—2R 5'—TTATTTTTGCAGATA

TCTCACAAAGTTGGTCA-3' 68 bIL-2F 5'—GTCAGCAATGTACA ,, AGATACAACTC-3'

bIL-2R 5'—GAGAGGCACTTAGTGA

TCAAGTCA-3'

Avian Disease Diagnostic

Laboratory, Manjadi,

(Sd.) Thiruvalla. Deputy Director.

Health Services Department

TENDER NOTICES

(1) No. A2-2423/2008/ICHG. 28th January 2009.

Sealed tenders are invited for the supply of Double Surface Phototherapy Unit-2 Nos. for the use in ICH, Kottayam. The tenders should be superscribed tender No. & date and addressed to the Superintendent, Institute of Child Health, Gandhinagar, Kottayam. Tender form can be had from the office of the undersigned on all working days on written request and payment in cash, M.O. Cheque, Draft etc. will not be accepted.

E. M. D.—1% of quoted value.

Cost of Tender forms :

Original—Rs. 150 +Tax.

Duplicate—Rs. 100 + Tax.

ദർഘാസ് ഫോറം തുറക്കുന്ന തീയതിയും സമയവും—

26-12-2009, 2 മണി.

ടെ≠റിനെ സംബന്ധിക്കുന്ന എല്ലാ നിബന്ധനകളും ഈ ടെ≠റിനും ബാധകമാണ്.

SPECIFICATION

1. Light source designed to give an irradiance upto 30 mw/cm2 between 430-490 mm wave length range at the mattress.

2. Blue labeled F OT12/20W or TL 52/20W 4 above & 4 below.

3. Height adjustable-upper one and lower one. Up to 10-15 cm to the baby, upper light source filtable so as take out baby.

4. Cooling Fan.

5. Clear Filter.

6. Timer

Infant Trolley:

Last date and time of sale of tender forms—

25-2-2009, 3 p. m.

Last date and time for receipt of tender—

26-2-2009, 1 p. m.

Date and time of opening tender—26-12-2009, 2 p. m.

All other Govt. rules regarding tenders are applicable to this tender also.

കോട്ടയം മെഡിക്കൽ കോളേജ് കുട്ടികളുടെ ആശുപത്രിയിലേക്ക് ഡബിൾ സർഫേസ് ഫോട്ടോതെറാപ്പി യൂണിറ്റ്-2 എണ്ണം വാങ്ങുന്നതിന് മുദ്രണം ചെയ്ത ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു. ടെ≠ർ അടക്കം ചെയ്ത കവറിന് പുറത്ത് ടെ≠ർ നമ്പർ, സ്വീകരിക്കുന്ന തീയതി എന്നിവ വ്യ‡മായി രേഖപ്പെടുത്തിയിരിക്കണം. ടെ≠ർ ഫോറം സൂപ്ര≠ിന്റെ ആഫീസിൽ നിന്നും എഴുതിക്കൊടുക്കുന്ന അപേക്ഷയിൽ പണം ഒടുക്കിയാൽ പകൽ മൂന്ന് മണിവരെ ലഭിക്കുന്നതാണ്. ചെക്ക്, ഡ്രാഫ്റ്റ്, മുതലായവ സ്വീകരി ക്കുന്നതല്ല. ടെ≠ർ ഫാറത്തിന്റെ വില ഒരു കാരണവശാലും തിരികെ ലഭിക്കുന്നതല്ല. ടെ≠ർ പൂർണ്ണമായോ, ഭാഗീകമായോ മുൻകൂർ അറിയിപ്പുകൂടാതെ നിരസിക്കുവാൻ സൂപ്ര≠ിന് അധികാരമു≠്.

ടെൻഡർ സമർപ്പിക്കുമ്പോൾ മൊത്തം വിലയുടെ ഒരു ശതമാനം നിരതദ്രവ്യമായും 50 രൂപയുടെ കേരള മുദ്രപത്രത്തിൽ ഒരു താത്ക്കാലിക എഗ്രിമെന്റ ് സൂപ്ര≠ിന്റെ പേരിൽ സമർപ്പിക്കേ≠താണ്.

ദർഘാസ് ഫോറത്തിന്റെ വില :

അസ്സൽ—രൂപ 150 + നികുതി.

പകർപ്പ്്—രൂപ 100 + നികുതി.

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും— 25-2-2009, 3 മണി.

ദർഘാസ് ഫോറം സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—26-2-2009, 1 മണി.

Clear acrylic collapsible side panels.

Acrylic Tray and mattress with Head up/Down facility.

Lower shelves

Infant care trolley should be detachable.

Mobile stand with height adjustment facility and easy swiveling of source.

(2) No. A2-2465/2008/ICHG. 28th January 2009.

Sealed tenders are invited for the supply of Multichannal Cardiac Analyser for the use in ICH Kottayam. The tenders should be superscribed tender No. & date and addressed to the Superintendent, Institute of Child Health, Gandhinagar, Kottayam. Tender form can be had from the office of the undersigned on all working days on written request and payment in cash, M.O., Cheque, Draft etc. will not be accepted.

E. M. D.—1% of quoted value.

Cost of tender form :

Original— Rs. 150 + Tax.

Duplicate—Rs. 100 + Tax.

Last date and time of sale of tender forms—

25-2-2009, 3 p. m.

Last date and time for receipt of tender —

26-2-2009, 1 p. m.

Date and time of opening tenders—26-2-2009, 2 p. m. All other Govt. rules regarding tender are applicable to this tender also.

കോട്ടയം മെഡിക്കൽ കോളേജ് കുട്ടികളുടെ ആശുപത്രിയിലേക്ക് മൾട്ടി ചാനൽ കാർഡിയാക് അനലൈസർ വാങ്ങുന്നതിന് മുദ്രണം ചെയ്ത ദർഘാസുകൾ ക്ഷണിച്ചു കൊള്ളുന്നു. ടെൻഡർ അടക്കം ചെയ്ത കവറിന് പുറത്ത് ടെൻഡർ നമ്പർ, സ്വീകരിക്കുന്ന തീയതി എന്നിവ വ്യ‡മായി രേഖപ്പെടുത്തിയിരിക്കണം. ടെൻഡർ ഫോറം സൂപ്ര≠ിന്റെ ആഫീസിൽ നിന്നും എഴുതിക്കൊടുക്കുന്ന അപേക്ഷയിൽ പണം ഒടുക്കിയാൽ പകൽ മൂന്ന് മണിവരെ ലഭിക്കുന്നതാണ്. ചെക്ക്, ഡ്രാഫ്റ്റ് മുതലായവ സ്വീകരിക്കുന്നതല്ല. ടെൻഡർ ഫോറത്തിന്റെ വില ഒരു കാരണവശാലും തിര ികെ ലഭിക്കുന്നതല്ല. ടെൻഡർ പൂർണ്ണമായോ ഭാഗികമായോ മുൻകൂർ അറിയിപ്പുകൂടാതെ നിരസിക്കുവാൻ സൂപ്ര≠ിന് അധികാരമു≠്.

ടെൻഡർ സമർപ്പിക്കുമ്പോൾ മൊത്തം വിലയുടെ ഒരു ശതമാനം നിരതദ്രവ്യമായും 50 രൂപയുടെ കേരള മുദ്ര പത്രത്തിൽ ഒരു താത്ക്കാലിക എഗ്രിമെന്റ ് സൂപ്ര≠ിന്റെ പേരിൽ സമർപ്പിക്കേ≠താണ്.

ദർഘാസ് ഫോറത്തിന്റെ വില :

അസ്സൽ—രൂപ 150 + നികുതി. പകർപ്പ്്—രൂപ 100 + നികുതി.

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും—25-2-2009, 3 മണി.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—26-2-2009, 1 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—26-2-2009, 2 മണി.

ഉപകരണത്തെ സംബന്ധിച്ച കൂടുതൽ വിവരങ്ങൾ സൂപ്ര≠ിന്റെ ഓഫീസിൽ നിന്നും അറിയാവുന്നതാണ്.

ടെൻഡറിനെ സംബന്ധിക്കുന്ന എല്ലാ നിബന്ധനകളും ഈ ടെൻഡറിനും ബാധകമാണ്.

SPECIFICATION

Automated 6 channel recording and 3+R LCD Monitor.

Defibrillation protection. Automated ECG Interpretation programme. Lait ECG recording memory. Thermal print out.

(3) No. A2-133/2009/ICHG. 30th January 2009.

Sealed tenders are invited for the supply of Measured Volume Set-2000 Nos. for the use in ICH, Kottayam. The tenders should be superscribed tender No. & Date and addressed to the Superintendent, Institute of Child Health, Gandhinagar, Kottayam. Tender form can be had from the office of the undersigned on all working days on written request and payment in cash, M.O., Cheque, Draft etc. will not be accepted.

Cost of tender forms:

Original— Rs. 150 + Tax.

Duplicate—Rs. 100 + Tax.

Gaz. No. 8/2009/DTP (Stores).

Last date and time of sale of tender forms—

2-3-2009, 3 p. m.

Last date and time for receipt of tender—

3-3-2009, 1 p. m.

Date and time of opening of tender—3-3-2009, 2 p. m.

All other Govt. rules regarding tender are applicable to this tender also.

കോട്ടയം മെഡിക്കൽ കോളേജ് കുട്ടികളുടെ ആശുപത്രിയിലേക്ക് മെഷേർഡ് വോളിയം സെറ്റ്-2000 എണ്ണം വാങ്ങുന്നതിന് മുദ്രണം ചെയ്ത ദർഘാസുകൾ ക്ഷണിച്ചു കൊള്ളുന്നു. ടെൻഡർ അടക്കം ചെയ്ത കവറിന് പുറത്ത് ടെൻഡർ നമ്പർ, സ്വീകരിക്കുന്ന തീയതി എന്നിവ വ്യ‡മായി രേഖപ്പെടുത്തിയിരിക്കണം. ടെൻഡർ ഫോറം സൂപ്ര≠ിന്റെ ആഫീസിൽ നിന്നും എഴുതിക്കൊടുക്കുന്ന അപേക്ഷയിൽ പണം ഒടുക്കിയാൽ പകൽ മൂന്ന് മണിവരെ ലഭിക്കുന്നതാണ്. ചെക്ക്, ഡ്രാഫ്റ്റ്, മുതലായവ സ്വീകരിക്കുന്നതല്ല. ടെ≠ർ ഫോറത്തിന്റെ വില ഒരു കാരണവശാലും തിരികെ ലഭിക്കുന്ന തല്ല. ടെൻഡർ പൂർണ്ണമായോ ഭാഗികമായോ മുൻകൂർ അറിയിപ്പുകൂടാതെ നിരസിക്കുവാൻ സൂപ്ര≠ിന് അധികാരമു≠്.

ടെൻഡർ സമർപ്പിക്കുമ്പോൾ മൊത്തം വിലയുടെ ഒരു ശതമാനം നിരതദ്രവ്യമായും 50 രൂപയുടെ കേരള മുദ്ര പത്രത്തിൽ ഒരു താത്ക്കാലിക എഗ്രിമെന്റ ് സൂപ്ര≠ിന്റെ പേരിൽ സമർപ്പിക്കേ≠താണ്.

ടെൻഡർ ഫോറം അസ്സലിന് 150 രൂപയും നികുതിയും പകർപ്പിന് 100 രൂപയും നികുതിയും ഒടുക്കേ≠താണ്.

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും—2-3-2009, 3 മണി.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—3-3-2009, 1 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—3-3-2009, 2 മണി.

ഉപകരണത്തെ സംബന്ധിച്ച കൂടുതൽ വിവരങ്ങൾ സൂപ്ര≠ിന്റെ ഓഫീസിൽ നിന്നും അറിയാവുന്നതാണ്. ടെ≠റിനെ സംബന്ധിക്കുന്ന എല്ലാ നിബന്ധനകളും ഈ ടെ≠റിനും ബാധമാണ്.

(Sd.) Institute of Child Health and Children's Hospital, Gandhi Nagar, Kottayam. Superintendent.

TENDER NOTICES

(1)

No. S/4558/2008. 15th January 2009.

Sealed tenders are invited from Manufacturers/ Authorised dealers/Agencies for the supply of following items to Government Mental Health Centre, Kozhikode.

ക്രമ വിതരണം നമ്പർ ചെയ്യേ≠തായ എണ്ണം Sl. Name of Quantity No.

Item Nos.

1 Refrigerator with stabilizer 165 Ltr. 2 2 Electrical Stabilizer instrument 1 3 High pressure water jet 80 Psi

1 phase 250 volt 1 4 Open inpeller pump 2 HP 1 PH 1 with 2.5 mm cable need with DOL starter

5 Water purifier 250V operating 2 voltage

6 Water filter

1 7 B.P. Apparatus

1 8 Stethoscope 1 9 Flame Photometre 1 10 Electric Heater-Hote Plate 2 Kw 1 11 Hemoglobin Meter 1 12 Shambles pitted leach 1 13 Psychological Testing Different material

സാധനങ്ങൾ

1 റഫ്രിജറേറ്റർ 165 ലിറ്റർ

സ്റ്റെബിലൈസറോടുകൂടി 2 2 ഇലക്ട്രിക്കൽ സ്റ്റെബിലൈസർ

ഇൻസ്ട്രുമെന്റ ്

1 3 ഹൈ പ്രഷർ വാട്ടർജെറ്റ് 80

പി. എസ്. എെ. 1 ഫേസ് 250 വാട്ട് 1 4 ഓപ്പൺ ഇംപൈലർ പമ്പ് 2

എച്ച്പി 1 പി. എച്ച്. 2.5 എം.എം. കേബിൾ റീൽ ഡി. ഒ.എൽ. സ്റ്റാർട്ടർ അടക്കം 1 5 വാട്ടർ പ്യൂരിഫയർ 1250 വാൾട്ട്

വോൾട്ടേജ് യു. വി. അടക്കം 2 6 വാട്ടർ ഫിൽറ്റർ 1 1 7 ബി. പി. അപ്പാരറ്റസ് 1 8 സ്റ്റെതസ്കോപ്പ് 9 ഫ്ളെയിം ഫോട്ടോ മീറ്റർ 1 10 ഇലക്ട്രിക് ഹീറ്റർ/ഹോട്ട് പ്ളെയ്റ്റ് 2 കെ. വി. 1 11 ഹീമോഗ്ളോബിൻ മീറ്റർ 1 1 12 ഷാംപിൾസ് പിറ്റഡ് ലീക്ക് 13 സൈക്കോളോജിക്കൽ വിവിധതരം ടെസ്റ്റിംഗ് മെറ്റീരിയൽ മന:ശാസ്ത്ര

test material

E.M.D.—1% of total cost of tendered items.

Cost of tender form :

Original—Rs. 400 + 12.5% VAT.

Duplicate—Rs. 200 + 12.5% VAT.

Last date and time for sale of tender form—

24-2-2009 at 3 p. m.

Date and time for receipt of tender—25-2-2009, 4 p. m.

Date and time for opening of tender—26-2-2009 at 11 a. m.

The envelops containing tender should be addressed to the Superintendent, Government Mental Health Centre, Kozhikode-16. Tender No. and date should be subscribed on the tender.

Cheque or Bond, DD towards the cost of tender form will not be accepted. Specification and other details regarding the tender will be available from the office during working hours. Tender should be accompanied by an agreement executed in Kerala Stamp Paper worth Rs. 50. The specimen of agreement is available in the last page of tender form.

The undersigned reserves the right to postpone or cancel the tender without assigning any reason whatsoever.

കോഴിക്കോട് ഗവൺമെന്റ ് മാനസിക ആരോഗ്യ കേന്ദ്രത്തിൽ താഴെ കൊടുത്തിരിക്കുന്ന ഉപകരണങ്ങൾ വിതരണം ചെയ്യുന്നതിന് ഉത്പാദക/അംഗീകൃത വിതരണക്കാർ/ ഏജൻസികൾ എന്നിവരിൽ നിന്നും മുദ്രവച്ച ടെ≠റുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

ടെസ്റ്റുകൾ ചെയ്യുവാനുള്ള ഉപകരണങ്ങൾ.

നിരതദ്രവ്യം—ടെ≠റിൽ കാണിച്ചിരിക്കുന്ന മൊത്തം തുകയുടെ 1%.

ടെ≠ർ ഫോറത്തിന്റെ വില :

ഒറിജിനൽ—രൂപ 400 + വാറ്റ് 12.5%. ഡ്യൂπിക്കേറ്റ് —രൂപ 200 + വാറ്റ് 12.5%.

ടെ≠ർ ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും—24-2-2009 വൈകുന്നേരം 3 മണി.

ടെ≠റുകൾ ഓഫീസിൽ സ്വീകരിക്കുന്ന തീയതിയും സമയവും—25-2-2009 വൈകുന്നേരം 4 മണിവരെ.

ടെ≠ർ തുറക്കുന്ന തീയതിയും സമയവും—

26-2-2009 രാവിലെ 11.30 മണി.

ടെ≠ർ അടങ്ങിയ കവറിൻമേൽ ടെൻഡർ നമ്പർ, തീയതി എന്നിവ എഴുതി സൂപ്ര≠്, ഗവൺമെന്റ ് മാനസിക ആരോഗ്യ കേന്ദ്രം, കോഴിക്കോട് -16 എന്ന വിലാസത്തിൽ അയയ്ക്കേ≠താണ്.

ടെ≠ർ ഫോറത്തിന്റ വിലയായി ചെക്ക്, ബാങ്ക് ഡി. ഡി. കൾ എന്നിവ സ്വീകരിക്കുന്നതല്ല. ടെ≠ർ ചെയ്യുന്ന സാധനങ്ങളെ സംബന്ധിച്ചും മറ്റുമുള്ള വിവരങ്ങൾ പ്രവൃത്തി ദിവസങ്ങളിൽ ആഫീസിൽ നിന്നും ലഭ്യമാണ്. നിരതദ്രവ്യം ദേശസാൽകൃത ബാങ്കിൽ നിന്നും ലഭിച്ച ഡിമാന്റ ് ഡ്രാഫ്റ്റായി നൽകേ≠തും 50 രൂപയുടെ കേരള മുദ്രപ്പത്രത്തിൽ ഒരു പ്രാഥമിക എഗ്രിമെന്റും ടെ≠റിന്റെ കൂടെ സമർപ്പിക്കേ≠താണ്. എഗ്രിമെന്റ ിന്റെ പകർപ്പ് ടെ≠ർ ഫോറത്തിന്റെ അവസാന പേജിൽ ലഭ്യമാണ്. നിരതദ്രവ്യം, പ്രാഥമിക എഗ്രിമെന്റ ് എന്നിവ അടക്കം ചെയ്യാത്ത ടെ≠റുകൾ സ്വീകരിക്കുന്നതല്ല.

ടെ≠റുകൾ 26-2-2009-ന് രാവിലെ 11.30-ന് ഹാജരായ ടെ≠റുകാരുടെ സാന്നിദ്ധ്യത്തിൽ സൂപ്ര≠ോ മറ്റ് അധികാരപ്പെടുത്തിയ ഉദ്യോഗസ്ഥരോ തുറക്കുന്നതാണ്. ടെ≠റുകൾ കാരണം മുൻകൂട്ടി കാണിക്കാതെ നീട്ടിവയ്ക്കുവാനും റദ്ദ് ചെയ്യുവാനുമുള്ള അധികാരം സൂപ്ര≠ിൽ നിക്ഷിപ്തമായിരിക്കും.

(2)

No. S/4559/2008. 14th January 2009.

Sealed tenders are invited from Manufacturers/ Authorized dealers/Agencies for the supply of following items to Government Mental Health Centre, Kozhikode.

Last date and time for sale of tender form—

24-2-2009 at 3 p. m.

Date and time for receipt of filled tender form—

25-2-2009, 4 p. m.

Date and time for opening of tender—26-2-2009 at 11 a. m.

Sl. Name of Item with Quantity

No. Specification Required

1 Copper vessels with lid 40 kg. 50cm dia, 70cm Height

3 2 Copper vessels with lid 65 kg, 39" dia,

30" Height

2 3 Copper vessels with lid 60 kg, 29" dia,

24" Height

1 4 Aluminium vessels/hindalium 29" dia,

16" Height

2 5 Knife iron hard

10 6 Chirava

5 7 Korika large iron 11" dia 38" handle 2 8 Iron chattukam 68" length 3 9 Aluminium bucket with Lid 22 ltr. 13 10 Aluminium bucket with Lid 10 ltr. 5 11 Aluminium bucket with Lid 5 ltr. 5 12 Stainless Steel bucket 15 ltr. 10 13 Stainless Steel bucket 10 ltr. 5 14 Steel thavi big

18 15 Plastic bucket 20 ltr. 33 16 Plastic mug

30 17 Plastic bucket for waste 9 18 Aluminium bucket 10 ltr. 1 19 Steel plate with round edge 425 20 Steel tumbler with round edge 125 21 Tiffin carrier big size 1 22 Plastic mats 3 meters 235 23 Plastic mats (Rubber) 3 meters 13 24 Rexin sheets —meters 15 25 File tray—plastic

8 26 Rubber sheets —meters 30 27 Plastic hat

16 28 Nail cutter

20 29 Plastic comb

110 30. File board

10 E.M.D.—1% of total cost by D. D.

Cost of tender form :

Original—Rs. 400 + 12.5% VAT.

Duplicate—Rs. 200 + 12.5% VAT.

The envelops containing tender should be addressed to the Superintendent, Government Mental Health Centre, Kozhikode-16.

Late and incomplete tenders will not be accepted. Tenders will be opened in the presence of tenderers or their authorized representatives who are present.

Application for tender form should be accompanied by cash remittance which will not be refunded under any circumstances. Cheque or Bank Draft will not be accepted towards the cost of tender form.

Specification and other details of each item will be available from office during office hours. Tender should be accompanied by a preliminary agreement executed in Kerala Stamp Paper worth Rs. 50. The form of agreement is available in the last page of tender form.

കോഴിക്കോട് ഗവൺമെന്റ ് മാനസിക ആരോഗ്യ കേന്ദ്രത്തിൽ താഴെ കൊടുത്തിരിക്കുന്ന പാത്രങ്ങളും ഉപകരണങ്ങളും വിതരണം ചെയ്യുന്നതിന് ഉത്പാദക/അംഗീകൃത വിതരണക്കാർ/ഏജൻസികൾ എന്നിവരിൽ നിന്നും മുദ്രവച്ച ടെ≠റുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

ക്രമ വിതരണം അളവ്/ നമ്പർ ചെയ്യേ≠തായ എണ്ണം സാധനങ്ങൾ

(1) (2)

(3) 1 ചെമ്പ് മൂടിയടക്കം 40 കിലോഗ്രാം തൂക്കം,

50 സെ. മീ. വ്യാസം, 70 സെ.മീ. ഉയരം 3 2 ചെമ്പ് മൂടിയടക്കം 65 കിലോഗ്രാം തൂക്കം,

39 ഇഞ്ച് വ്യാസം, 30 ഇഞ്ച് ഉയരം 2 3 ചെമ്പ് മൂടിയടക്കം 60 കിലോഗ്രാം തൂക്കം,

29 ഇഞ്ച് വ്യാസം, 24 ഇഞ്ച് ഉയരം 1 4 അലൂമിനിയം/ഹിന്റാലിയം പാത്രം 29 ഇഞ്ച് വ്യാസം, 16 ഇഞ്ച് ഉയരം 2 5 ഇരുമ്പ് കത്തി 10 6 ചിരവ 5 7 ഇരുമ്പ് കോരിക (വലുത്) 11 ഇഞ്ച് വ്യാസം, 38 ഇഞ്ച് പിടി നീളം

2 8 ഇരുമ്പ് ചട്ടുകം 68 ഇഞ്ച് നീളം 3 9 അലൂമിനിയം ബക്കറ്റ് മൂടിയടക്കം 22 ലിറ്റർ 13 10 അലൂമിനിയം ബക്കറ്റ് മൂടിയടക്കം 10 ലിറ്റർ 5 11 അലൂമിനിയം ബക്കറ്റ് മൂടിയടക്കം 5 ലിറ്റർ 5 12 സ്റ്റെയിൻലെസ് സ്റ്റീൽ ബക്കറ്റ് 15 ലിറ്റർ 10 13 സ്റ്റെയിൻലെസ് സ്റ്റീൽ ബക്കറ്റ് 10 ലിറ്റർ 5 14 സ്റ്റീൽ തവി (വലുത്) 18 15 πാസ്റ്റിക് ബക്കറ്റ് 20 ലിറ്റർ 33 30 16 πാസ്റ്റിക് മഗ് 17 πാസ്റ്റിക് ബക്കറ്റ് (വേസ്റ്റ് ബക്കറ്റ്) 9 18 അലൂമിനിയം ബക്കറ്റ് 10 ലിറ്റർ 1 19 സ്റ്റീൽ πെയിറ്റ് (വക്ക് ഉരു≠ത്) 42516 (1)

(2)

20 സ്റ്റീൽ ടംബ്ളർ (വക്ക് ഉരു≠ത്) 125 21 ടിഫിൻ കാരിയർ (വലുത്) 1 22 πാസ്റ്റിക് മാറ്റ് 3 മീറ്റർ 235 23 πാസ്റ്റിക് മാറ്റ് (റ∫ർ) 3 മീറ്റർ 13 24 റക്സിൻ ഷീറ്റ്—മീറ്റർ 15 25 ഫയൽ ട്രെ—πാസ്റ്റിക് 8 26 റ∫ർ ഷീറ്റ്—മീറ്റർ 30 16 27 πാസ്റ്റിക് ഹാറ്റ് 20 28 നെയിൽ കട്ടർ 110 29 πാസ്റ്റിക് ചീർപ്പ് 10 30 ഫയൽ ബോർഡ്

നിരതദ്രവ്യം—മൊത്തം ടെ≠ർ തുകയുടെ 1%.

ടെ≠ർ ഫോറത്തിന്റെ വില :

ഒറിജിനൽ—രൂപ 400 + 12.5 % വാറ്റ്. ഡ്യൂπിക്കേറ്റ് —രൂപ 200 + 12.5% വാറ്റ്.

ടെ≠ർ ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും—24-2-2009, വൈകുന്നേരം 3 മണി.

പൂരിപ്പിച്ച ടെ≠ർ ഫോറം ഓഫീസിൽ സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—25-2-2009 വൈകുന്നേരം 4 മണിവരെ.

ടെ≠ർ തുറക്കുന്ന തീയതിയും സമയവും—

26-2-2009, രാവിലെ 11 മണി.

വൈകി കിട്ടുന്നതും അപൂർണ്ണവുമായ ടെ≠ർ സ്വീകരിക്കുന്നതല്ല. ഹാജരാക്കുന്ന ടെ≠റുകൾ ആഫീസിൽ വച്ച് സൂപ്ര≠ോ, അധികാരപ്പെടുത്തിയ മറ്റ് ഉദ്യോഗസ്ഥരോ ടെ≠ർ തുറക്കുന്നതായിരിക്കും. ടെ≠റുകൾ നീട്ടിവയ്ക്കുന്നതിനും റദ്ദ് ചെയ്യുന്നതിനുമുള്ള അധികാരം സൂപ്ര≠ിൽ നിക്ഷിപ്തമായിരിക്കും.

ടെ≠റിനോടൊപ്പം 50 രൂപയുടെ മുദ്രപത്രത്തിൽ തയ്യാറാക്കിയ പ്രാഥമിക ഉടമ്പടി അടക്കം ചെയ്യേ≠താണ്. നിരതദ്രവ്യവും പ്രാഥമിക ഉടമ്പടിയും ഇല്ലാത്ത ടെ≠റുകൾ നിരസിക്കുന്നതായിരിക്കും.

കൂടുതൽ വിവരങ്ങൾ പ്രവർത്തി ദിവസങ്ങളിൽ ആഫീസിൽ നിന്നും ലഭ്യമാണ്.

Govt. Mental Health Centre, Kozhikode.

(Sd.) Superintendent.

TENDER NOTICE

No. S3/6978/08/IMCH. 31st January 2009.

Sealed and competitive tenders are invited for the purchase of Oxygen Flow meter with regulator and Humidifying bottle ISI standard–59 Nos. for the use of this institution. The cover containing tenders should be superscribed with tender numbers as indicated in the statements below and should be addressed to the Superintendent, Institute of Maternal and Child Health, Medical College P.O., Calicut-8, Kerala. Tender will be opened at 11 a.m. on 28-2-2009 in the presence of such of the tenderers or their authorized persons who may be present at that time. Belated tenders will not be accepted.

(3) Indending tenderers may on application to the Superintendent, IMCH, Medical College, Calicut, Kerala will obtain the requisite tender form in which the tenders to be submitted. Application for tender forms should be accompanied by cash remittance as noted below for a set of tender forms, which will not be refunded under any circumstances. The tender forms are not transferable. Postage stamp, Draft, etc. will not be acceped towards the cost of tender forms. Tender forms will not be sent by VPP. Money order will be accepted. If tender forms are to be sent by post, Rs. 50 should be paid additionally towards the postage coverage. Tender should be accompanied by EMD amounting to 1% (Rounded to nearest to 1 Rupee) of the total cost of articles tendered for. The tenderers should produce samples of the items, Brand name and Brochures. The tenders do not accompanied by sufficient EMD will not be entertained. The indenting tenderers should also ready for demonstration.

Tender No.— S3/6978/08/IMCH.

Cost of tender forms (Including Tax):

Original—Rs. 450.

Duplicate—Rs. 225.

Postage charge if any—Rs. 50 (Additional) Closing date and time of sale of tender—

26-2-2009, 3 p. m.

Last date and time of receipt of tender—27-2-2009, 5 p. m.

Opening date and time of tender—28-2-2009, 11 a. m.

Date upto which the rates are to be firm—

31-12-2009.

Further details can be had from the office of the undersigned during the office hours on any working day. The undersigned has the right to postpone/cancel the tender process without prior notice and decision taken by the Superintendent will be final.

കോഴിക്കോട് മെഡിക്കൽ കോളേജ് എെ. എം. സി. എച്ച്. ആശുപത്രിയിലേക്ക് ഓക്സിജൻ ഫ്ളോമീറ്റർ വിത്ത് റഗുലേറ്റർ ആന്റ ് ഹുമിഡിഫൈയിങ്ങ് ബോട്ടിലുകൾ-എെ. എസ്. എെ. സ്റ്റാൻന്റേർഡ്-59 എണ്ണം വിതരണം ചെയ്യുന്നതിന് നി›ിത ഫോറത്തിലുള്ള മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു. ദർഘാസുകൾ അടക്കം ചെയ്തിട്ടുള്ള കവറിനുമുകളിൽ ദർഘാസ് നമ്പർ എഴുതി സൂപ്ര≠,് ഇൻസ്റ്റിറ്റ്യൂട്ട് ഓഫ് മെറ്റേർണൽ ആന്റ ് ചൈൽഡ് ഹെൽത്ത്, കോഴിക്കോട്-8, കേരളം എന്ന വിലാസത്തിൽ അയയ്ക്കേ≠താണ്. ദർഘാസുകൾ താഴെ ചേർത്തിട്ടുള്ള തീയതിയിലും സമയത്തും അപ്പോൾ ഹാജ രായിട്ടുള്ള ദർഘാസ് സമർപ്പിച്ചവരുടെയോ അവർ ചുമതലപ്പെടുത്തിയിട്ടുള്ള ഏജന്റുമാരുടെയോ സാന്നിദ്ധ്യത്തിൽ 28-2-2009 രാവിലെ 11 മണിക്ക് തുറക്കുന്നതാണ്. വൈകിക്കിട്ടുന്ന ദർഘാസുകൾ പരിഗണിക്കുന്നതല്ല. ദർഘാസു കൾ സമർപ്പിക്കുവാൻ ആഗ്രഹിക്കുന്നവർ ഈ ഓഫീസിൽ അപേക്ഷിക്കുന്നപക്ഷം ആവശ്യമായ ദർഘാസ് ഫോറങ്ങൾ17 താഴെ കൊടുത്തിരിക്കുന്ന പ്രകാരം തുക അടച്ചാൽ ലഭിക്കുന്നതാണ്. ദർഘാസ് ഫോറങ്ങൾ കൈമാറ്റം ചെയ്യു വാൻ പാടുള്ളതല്ല. ചെക്കുകൾ പോസ്റ്റേജ് സ്റ്റാമ്പുകൾ, ഡ്രാഫ്റ്റുകൾ എന്നിവ ദർഘാസ് ഫോറത്തിന്റെ വിലയായി സ്വീകരിക്കുന്നതല്ല. ഫോറങ്ങൾ വി.പി.പി. ആയി അയക്കുന്ന തല്ല. ടെ≠ർ ഫോറം തപാലിൽ ആവശ്യമുള്ളവർ തപാൽ ചാർ÷ായി 50 രൂപ കൂടുതൽ അടയ്ക്കേ≠താണ്.

ടെ≠ർ സമർപ്പിക്കുന്നവർ വിതരണം ചെയ്യുന്ന സാധന ത്തിന്റെ ഘടനയും മറ്റു വിവരങ്ങളും അടങ്ങിയ ബ്രോഷർ അടക്കം ചെയ്തിരിക്കണം. അല്ലെങ്കിൽ മാതൃക അടയാള പ്പെടുത്തി അടക്കം ചെയ്തിരിക്കണം. ടെ≠ർ സമർപ്പിക്കുന്നവർ ആവശ്യപ്പെട്ടാൽ വിതരണം ചെയ്യുന്ന സാധനത്തിന്റെ സാമ്പിൾ ഗുണനിലവാര പരിശോധനയ്ക്ക് ഹാജരാക്കേ≠താണ്. ടെക്നിക്കൽ കമ്മിറ്റിയുടെ അംഗീകാരത്തിനുശേഷം തിരഞ്ഞെടുക്കപ്പെടുന്ന സ്ഥാപനം സാധനത്തിന്റെ ഒരു സാമ്പിൾ സമർപ്പിക്കേ≠താണ്. സാധനത്തിന് ഗ്യാര≠ി നൽകേ≠താണ്. നിരതദ്രവ്യമായി ടെ≠റിൽ കാണിക്കുന്ന മൊത്തവിലയുടെ ഒരു ശതമാനം സംഖ്യയ്ക്കുള്ള ബാങ്ക് ഡ്രാഫ്റ്റ് സൂപ്ര≠ിന്റെ പേരിലെടുത്ത് അടക്കം ചെയ്തിരി ക്കണം. അല്ലാത്ത ടെ≠റുകൾ നിരസിക്കുന്നതാണ്.

ടെ≠ർ നമ്പർ—എസ്3-6978/08/എെ.എം.സി.എച്ച്. ദർഘാസ് ഫോറത്തിന്റെ വില (നികുതിയടക്കം)—

അസ്സൽ—450 രൂപ.

പകർപ്പ്—225 രൂപ.

തപാലിൽ ലഭിക്കുന്നതിന്—50 രൂപ (അധികം) ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും—26-2-2009 വൈകുന്നേരം 3 മണി.

ദർഘാസ് ഫോറം സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—27-2-2009 വൈകുന്നേരം 5 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—28-2-2009, രാവിലെ 11 മണി.

നിരക്കുകൾ പ്രാബല്യത്തിലിരിക്കേ≠ തീയതി—31-12-2009.

കൂടുതൽ വിവരങ്ങൾ പ്രവൃത്തി സമയത്ത് ഈ ഓഫീസിൽ നേരിട്ട് അന്വേഷിച്ചറിയാവുന്നതാണ്. ടെ≠ർ നടപടികൾ മുന്നറിയിപ്പില്ലാതെ നീട്ടിവയ്ക്കാനോ, നിർത്തി വയ്ക്കാനോ ഉള്ള അധികാരം സൂപ്ര≠ിൽ നിക്ഷിപ്തമാണ്.

Institute of Maternal and (Sd.) Child Health, Kozhikode. Superintendent.

RE-TENDER NOTICE

No. B2-14512/2008. 31st January 2009.

Sealed competitive and superscribed tenders are invited from reputed manufacturers/dealers to supply Spare Parts to the various Hospitals attached to the District Medical Office of Health, Kannur for the year 2008-09.

Tenders should be superscribed "Tenders for the supply of Spare Parts for the repair for Hospital Equipments of Kannur District for the year 2008-09" and addressed to the District Medical Officer of Health, Gaz. No. 8/2009/DTP (Stores).

Kannur, Civil Station P. O., Kannur-670 002. Tender should quote for all the items (Name of spare parts) shall be quoted including comprehensive AMC for 5 years.

Intending tenderers may an application to the District Medical Officer (Health), Kannur obtain the requisite tender forms against cash remittance, in which the tender to be submitted, Cheques, Postal Orders, Demand Draft etc. will not be accepted towards the cost of tender forms and the tender forms will not be sent by V. P. P.

List of Spareparts and conditions of tenders will be had from the office along with tender forms.

Probable Amount of Cost—Rs. 98,865

Cost of tender form :

Original—Rs. 700 + 12.5% VAT.

Duplicate—Rs. 350 + 12.5% VAT.

Date and time for sale of tender forms—20-2-2009 to 26-2-2009, 3 p. m.

Last date and time for receipt of tender forms—

28-2-2009, 12 Noon.

Date and time of opening of tender forms—28-2-2009, at 3 p. m.

Date upto to which the rates are to be remain firm for acceptance—31-3-2009.

Period of supply—within 15 days of receipts of supply order.

GENERAL CONDITIONS

1. Tender forms are neither transferable nor the cost refundable.

2. A preliminary agreement in the format given in the tender form is to be executed in Kerala Stamp Paper of value of Rs. 50 by the successful tenderer.

3. An EMD at 1% of the cost of items tendered for shall accompany the tenderer by Demand Draft drawn in favour of District Medical Officer (Health), Kannur subject to the minimum of Rs. 1,000. The firms who are exempted for furnishing EMD should enclose the attested copy of the exemption order. EMD will not carry any interest.

4. Rates and sales tax and condition of supply of articles should be clearly stated in respect of each item.

5. Articles should be supplied within 15 days of the receipt of supply order at their own cost at District Medical Officer (Health), Kannur.

6. Tenders will be opened in the presence of such of the tenderers or their authorized representatives who may be present at the time of opening of tender.

7. Due to any reason if the day of opening the tender is declared as a public holiday, the same will be opened on the next working day.

8. The District Medical Officer (Health), Kannur and the purchasing committee possess the right to accept or reject any tender without assigning any reason thereof.

9. Successful tenderer should furnish 5% of total cost as security deposit.

10. All the conditions applicable to Government tender will be applicable in this case also.

Further details if any can be had from the office of the undersigned during working hours.

കണ്ണൂർ ജില്ലാ മെഡിക്കൽ ആഫീസിന്റെ കീഴിൽ പ്രവർത്തിക്കുന്ന വിവിധ ആശുപത്രികളിലെ ആശുപത്രി ഉപകരണങ്ങൾ റിപ്പയർ ചെയ്ത് ഉപയോഗയോഗ്യമാക്കുന്നതിന് വേ≠ി പട്ടികയിൽ കാണിച്ചിരിക്കുന്ന സ്പെയർ പാട്സുകൾ വിതരണം ചെയ്യുന്നതിന് മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചു കൊള്ളുന്നു. ദർഘാസുകൾ അയക്കുന്ന കവറിനു മുകളിൽ ''ജില്ലാ മെഡിക്കൽ ആഫീസ് കണ്ണൂർ-ന്റെ കീഴിലുള്ള വിവിധ ആശുപത്രികളിലേക്ക് ഉപകരണങ്ങൾ റിപ്പയർ ചെയ്യുന്നതിന് ആവശ്യമായ സ്പെയർ പാട്സുകൾ വിതരണം ചെയ്യുന്നതി നുള്ള ദർഘാസ്'' എന്ന് ആലേഖനം ചെയ്യേ≠തും ജില്ലാ മെഡിക്കൽ ആഫീസർ (ആരോഗ്യം), സിവിൽ സ്റ്റേഷൻ പി. ഒ., കണ്ണൂർ എന്ന പേരിൽ അയക്കേ≠തുമാണ്.

ഉദ്ദേശ അടങ്കൽ തുക—രൂപ 98,865. ദർഘാസ് ഫോറത്തിന്റെ വില :

അസ്സൽ—രൂപ 700 + 12.5% വാറ്റ്. പകർപ്പ്—രൂപ 350 + 12.5% വാറ്റ്.

4. ഓരോയിനത്തിന്റെയും വിൽപന നികുതി, വിതരണം ചെയ്യുന്നതിനുള്ള നിബന്ധനകൾ എന്നിവ വ്യ‡മായും രേഖപ്പെടുത്തേ≠താണ്.

5. സപ്ളൈ ഓർഡർ ലഭിച്ച് 15 ദിവസത്തിനകം ഉപകരണങ്ങൾ ജില്ലാ മെഡിക്കൽ ആഫീസിൽ സ്വന്തം ചെലവിൽ സപ്ളൈ ചെയ്യേ≠താണ്.

6. ദർഘാസുകൾ സമർപ്പിച്ചവരുടെയോ അവരുടെ പ്രതിനിധി കളുടെയോ സാന്നിദ്ധ്യത്തിൽ (ഉ≠െങ്കിൽ മാത്രം) പ്രഖ്യാപിത തീയതിക്ക് തുറന്ന് പരിശോധിക്കേ≠താണ്.

7. ദർഘാസുകൾ തുറക്കാൻ തീരുമാനിച്ച ദിവസം പൊതു ഒഴിവ് പ്രഖ്യാപിക്കപ്പെട്ടാൽ തൊട്ടടുത്ത ദിവസം ദർഘാസുകൾ തുറക്കുന്നതാണ്.

8. ദർഘാസുകൾ യാതൊരു കാരണവും കാണിക്കാതെ സ്വീകരിക്കാനും നിരസിക്കാനും ഉള്ള അധികാരം ജില്ലാ മെഡിക്കൽ ആഫീസറിലും പർച്ചേസിംഗ് കമ്മിറ്റിയിലും നിക്ഷിപ്തമാണ്.

9. വിജയിയായ ദർഘാസുകാരൻ മൊത്ത തുകയുടെ 5% സെക്യൂരിറ്റി ഡെപ്പോസിറ്റായി നൽകേ≠താണ്.

10. സർക്കാർ ദർഘാസുകൾക്കായി നിലവിലുള്ള എല്ലാ നിബന്ധനകളും ഈ ദർഘാസിനും ബാധകമാണ്.

വിശദ വിവരങ്ങൾക്ക് പ്രവൃത്തി ദിവസങ്ങളിൽ ഈ ഓഫീസുമായി ബന്ധപ്പെടുക.

LIST OF SPARE PARTS

Sl. Name of Parts Quantity

No. Autoclave

ദർഘാസ് ഫോറങ്ങൾ വിൽക്കുന്ന തീയതിയും സമയവും—20-2-2009 മുതൽ 26-2-2009, 3 മണി വരെ.

ദർഘാസ് ഫോറങ്ങൾ സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—28-2-2009, 12 മണി വരെ.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—28-2-2009, 3 മണി വരെ.

നിരക്ക് നിലവിലു≠ാകേ≠ തീയതി—31-3-2009.

സാധനം വിതരണം ചെയ്യേ≠ കാലയളവ്—വിതരണ അറിയിപ്പ് ലഭിച്ച് 15 ദിവസത്തിനകം.

ദർഘാസ് ഫോറം ലഭിക്കുന്നതിന് മുകളിൽ പറഞ്ഞ വിലാസത്തിൽ രൊക്കം പണം അടച്ച് അപേക്ഷിക്കേ≠തും പ്രസ്തുത ഫോറത്തിൽ മാത്രം ദർഘാസുകൾ സമർപ്പിക്കേ≠ തുമാകുന്നു. ദർഘാസ് ഫോറത്തിന്റെ വിലയായി ചെക്കുകൾ, ഡ്രാഫ്റ്റുകൾ, പോസ്റ്റൽ ഓർഡറുകൾ എന്നിവ സ്വീകരിക്കു കയോ വി. പി. പി.യായി അയച്ചുതരികയോ ചെയ്യുന്നതല്ല.

പൊതു നിബന്ധനകൾ

1. ദർഘാസ് ഫോറം കൈമാറ്റം ചെയ്യാൻ പാടുള്ളതല്ല.

2. വിജയപ്രദമായ ദർഘാസുകൾ 50 രൂപയുടെ മുദ്രപത്ര ത്തിൽ ടെ≠ർ ഫോറത്തിൽ പറഞ്ഞ പ്രകാരമുള്ള സമ്മതപത്രവും ഒപ്പിട്ടുതരേ≠താണ്.

3. ദർഘാസ് തുകയുടെ 1% ഇ.എം.ഡി. ഇനത്തിൽ ജില്ലാ മെഡിക്കൽ ആഫീസർ (ആരോഗ്യം), കണ്ണൂരിന്റെ പേരിൽ മാറാവുന്ന ഡി. ഡി. രൂപത്തിൽ സമർപ്പിക്കേ≠താണ്. ചുരുങ്ങിയ ഇ.എം.ഡി. 1000 രൂപ. ഇ. എം. ഡി. നൽകുന്നതിൽ നിന്ന് ഒഴിവാക്കപ്പെട്ട സ്ഥാപനങ്ങൾ പ്രസ്തുത ഉത്തരവിന്റെ പകർപ്പ് സമർപ്പിക്കേ≠താണ്. ഇ.എം.ഡി. തുകയ്ക്ക് പലിശ ലഭിക്കുന്നതല്ല.

1 Coil-9000 Watts 6 Nos.

2 Coil-2000 Watts 50 ,, 3 Coil-1500 Watts B. P. Apparatus 30 ,, 4 Bulb with Valve 50 ,, 5 Bladder 50 ,, 6 Mercury

1 Kg.

7 Connector 25 Nos.

8 Cuff

50 ,, 9 Glass tube Sterilizer 10 ,, 10 Thermostat Switch Refrigerator 10 ,, 11 Auto-defrost thermostat switch 10 ,, 12 Thermostat Switch Ordinary 10 ,, 13 Compressor Kelvinator 1/6 6 ,, 14 Compressor Godrej 1/6 6 ,,

(Sd.) District Medical Office, Kannur. District Medical Officer (H). പുനർ ദർഘാസ് പരസ്യം

നമ്പർ സി. 379/08. 2009 ജനുവരി 28.

വടക്കാഞ്ചേരി താലൂക്കാശുപത്രിയിലേക്ക് ആവശ്യമായ താഴെ പറയുന്ന ഇനങ്ങൾ വിതരണം ചെയ്യുന്നതിന് താൽപര്യ മുള്ളവരിൽ നിന്ന് സീലുവച്ച ദർഘാസുകൾ താഴെ പറയുന്ന നിബന്ധനകൾക്ക് വിധേയമായി ക്ഷണിച്ചുകൊള്ളുന്നു.

ക്രമ

മതിപ്പുവില നമ്പർ ഇനം അളവ് (രൂപ) 1. എൽ. സി. ഡി. പ്രൊജക്ടർ 1 എണ്ണം 15,000 2. അൾട്രാസോണിക്ക് സ്കെയിലർ 1 ,, 25,000 വിത്ത് ടിപ്സ് പിസോ സ്കെയിലർ

3. ലൈറ്റ് ക്യൂർ യൂണിറ്റ് ആന്റ ് 1,3 20,000 ഫില്ലിഗ് മെറ്റീരിയൽ ബോക്സ് 4. കോപ്പർ അമാൽഗം പൗഡർ 10 ,, 500

(1 എണ്ണം) 5. ഗ്ളാസ് എെനോമർ ഫ്യൂജി 2 എണ്ണം 2,000

(1 എണ്ണം) ബിഗ്ടൈപ്പ് I

6. ഗ്ളാസ് എെനോമർ ഫ്യൂജി 3 ,, 1,600

(1 എണ്ണം) ബിഗ്ടൈപ്പ് II

7. അക്വാഗാർഡ് ഫോർ 1 ,, 8,000 പ്യൂരിഫൈഡ് വാട്ടർ ആന്റ ്ജഗ്

നിബന്ധനകൾ

1. നിലവാരമുള്ള ഇനങ്ങൾ ഏറ്റവും കുറഞ്ഞ നിരക്കിൽ സπൈ ചെയ്യുന്നതിന് രേഖപ്പെടുത്തിയവർക്ക് ഉറപ്പിക്കുന്നതും ടി വ്യ‡ിക്ക് 50 രൂപയുടെ മുദ്രപത്രത്തിൽ ഉടമ്പടി ഒപ്പ് വച്ച് നൽകേ≠തുമാണ്.

2. ദർഘാസ് ഉറപ്പിക്കുന്ന ടി വ്യ‡ി സ്വന്തം ഉത്തരവാദിത്വ ത്തിലും ചിലവിലും സാധനങ്ങൾ എത്തിച്ചുതരേ≠തും ഇനങ്ങൾക്ക് ഗ്യാര≠ി/വാറ≠ി നൽകേ≠തുമാണ്.

ദർഘാസുകൾ കാരണരഹിതമോ അല്ലാതെയോ നിരാകരി ക്കുന്നതിനുള്ള അവകാശം സൂപ്ര≠ിൽ നിക്ഷിപ്തമാണ്.

(ഒപ്പ്) താലൂക്കാസ്ഥാന ആശുപത്രി, വടക്കാഞ്ചേരി. സൂപ്ര≠്.

Department of Industrial Training

8. ടെലിവിഷൻ 21 ഫ്ളാറ്റ് (കളർ) 1 ,, 10,000 9. വാക്വം ക്ലീനർ 1 ,, 10,000 1 ,, 5,000 10. ആട്ടോക്ലേവ് 11. വെയിറ്റിംഗ് ചെയർ 10 ,, 30,000 (3 ഇരുമ്പ് കസേരകൾ ബഞ്ച് പോലെ ക്രമീകരിച്ചത്)

12. എക്സ്റേ യൂണിറ്റിലേക്ക് 1 , , 4,000 ആവശ്യമായ ഇനങ്ങൾ- പ്രൊട്ടക്റ്റീവ് ബാരിയർ ലെഡ് 1 ,, ക്ലാസ്

QUOTATION NOTICE

No. A8/126/09. 30th January 2009.

Sealed quotations are invited from manufacturers and authorised dealers for the supply of the machinery and equipments for training in the food processing trade to ITI for Women, Kollam-12.

Sl. Quotation Items Approximate

No. No. Cost (Rs.)

ലെഡ് അപ്പ്റോൺ 1 ,,

ഗോണാൾഡ് ഷീൽഡ് 2 ,,

മുൻവാതിൽ ലെഡ് കവർ 2 ,, ചെയ്യൽ സൈസ് 6 1/2 അടി x 1 3/4 അടി

ദർഘാസ് ഫോറത്തിന്റെ വില :

അസ്സൽ—രൂപ 400 + 10% നികുതി.

പകർപ്പ്്—രൂപ 200 + 10% നികുതി.

ദർഘാസ് ഫോറം വിൽപന തുടങ്ങുന്ന തീയതി—

20-2-2009.

ദർഘാസ് വിൽപന അവസാനിക്കുന്ന തീയതി—27-2-2009.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—28-2-2009, 11 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—28-2-2009, 3 മണി.

ക്വാട്ട് ചെയ്യുന്ന തുകയുടെ 1% ഏണസ്റ്റ് മണി ഡെപ്പോസിറ്റ് ആയി ടെൻഡറിനോടൊപ്പം സൂപ്ര≠ിന്റെ പേരിൽ ഡി. ഡി. ആയി സമർപ്പിക്കേ≠താണ്.

കവറിന് മുകളിൽ "ആശുപത്രി ഉപകരണങ്ങൾക്കുള്ള ദർഘാസ്" എന്ന് രേഖപ്പെടുത്തണം.

1 A8/121/2009 Mawa machine and steam

jacketed kettle 60,000 2 A8/122/2009 7 items such as moisture

meter and cupsealer 3,00,000 3 A8/123/2009 5 items such as cabinet

dryer and oven 7,75,000 4 A8/124/2009 Refractometer and

electric oven 5,50,000 5 A8/125/2009 Fermentor and pulping

machine 2,50,000 6 A8/126/2009 Fruit mill junior model 8,00,000 7 A8/127/2009 Gel meter and vacuum pan 7,00,000 8 A8/128/2009 6 items such as flour mill

and bread cutting machine 7,50,000 9 A8/129/2009 Packing machine hand

operated 7,00,000 10 A8/130/2009 Sugar coating pan solar

dryer, electric oven 3,90,000 11 A8/131/2009 Automatic pouch machine 5,00,000 12 A8/132/2009 7 items such as Hammer mill and mini grain mill 3,00,000 13 A8/133/2009 6 items such as wheat flour mill and vinegar generator 1,60,000 List of items and format of quotation shall have from this office on working hours. Format shall be sent by post on request with self addressed, stamped envelope.

Quotation may be submited separately for each of the above 13 notices.

Last date and time for submission of quotation—

28-2-2009, 2 p. m.

Date and time of opening of tender—

28-2-2009, 2.30 p. m.

കൊല്ലം വനിതാ എെ.ടി.എെ.-ലെ ഫുഡ് പ്രോസസ്സിംഗ് ട്രേഡിൽ പരിശീലനം നൽകുന്നതിനുള്ള യന്ത്രോപകരണങ്ങൾ വിതരണം ചെയ്യുന്നതിനായി മുദ്രവച്ച ക്വട്ടേഷനുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

ക്രമ ക്വട്ടേഷൻ ഉപകരണങ്ങൾ മതിപ്പുവില നമ്പർ നമ്പർ

(രൂപ) 1. എ8/121/09 മാവ മെഷീൻ 60,000

സ്റ്റീം ജാക്കറ്റഡ് കെറ്റിൽ

2 എ8/122/09 മോയ്സ്ചർ മീറ്റർ 3,00,000

കപ് സീലർ തുടങ്ങിയ 7 ഉപകരണങ്ങൾ 3 എ8/123/09 ക്യാബിനറ്റ് ഡ്രൈയർ, 7,75,000 ഓവൻ തുടങ്ങിയ 5 ഉപകരണങ്ങൾ 4 എ8/124/09 റിഫ്രാക്ടോ മീറ്റർ 5,50,000

ഇലക്ട്രിക്ക് ഓവൻ

5 എ8/125/09 ഫെർമന്റർ 2,50,000

പൾപ്പിംഗ് മെഷീൻ

6 എ8/126/09 ഫ്രൂട്ട് മിൽ ജൂനിയർ 8,00,000

മോഡൽ

7 എ8/127/09 ജൽമീറ്റർ വാക്വം പാൻ 7,00,000 8 എ8/128/09 ഫ്ളവർ മിൽ 7,50,000

ബ്രെഡ് കട്ടിംഗ് മെഷീൻ

9 എ8/129/09 പാക്കിംഗ് മെഷീൻ 7,00,000

ഹാൻഡ് ഓപ്പറേറ്റഡ്

10 എ8/130/09 ഷുഗർകോട്ടിംഗ് പാൻ, 3,90,000

സോളാർഡ്രൈയർ ഇലക്ട്രിക്ക് ഓവൻ

11 എ8/131/09 ആട്ടോമാറ്റിക്ക് പൗച്ചിംഗ് 5,00,000

മെഷീൻ

12 എ8/132/09 ഹാമർ മിൽ, 3,00,000

മിനിഗ്രെയ്ൻ മിൽ തുടങ്ങി 7 ഉപകരണങ്ങൾ

13 എ8/133/09 വീറ്റ് ഫ്ളവർ മിൽ, വിനീഗർ 1,60,000

ജനറേറ്റർ തുടങ്ങി 6 ഉപകരണങ്ങൾ

ഉപകരണങ്ങളുടെ ലിസ്റ്റും, ക്വട്ടേഷൻ ഫോർമാറ്റും പ്രവൃത്തി സമയങ്ങളിൽ ആഫീസിൽനിന്ന് ലഭിക്കുന്നതാണ്. തപാലിൽ വേ≠വർ മതിയായ സ്റ്റാമ്പ് പതിച്ച മേൽവിലാസം എഴുതിയ കവർ സഹിതം ആവശ്യപ്പെട്ടാൽ അയച്ചുതരുന്നതാണ്.

മുകളിൽ കൊടുത്തിട്ടുള്ള 13 ക്വട്ടേഷൻ നോട്ടീസുകൾക്കും പ്രത്യേകം ക്വട്ടേഷൻ നൽകേ≠താണ്.

ക്വട്ടേഷൻ ലഭിക്കേ≠ അവസാന തീയതിയും സമയവും—28-2-2009, 2 മണി.

ക്വട്ടേഷൻ തുറക്കുന്ന തീയതിയും സമയവും—

28-2-2009, 2.30 മണി.

Industrial Training Institute (Sd.) for Women, Kollam. Principal. Phone; 0474-2793714

TENDER NOTICES

(1)

[C4/01/09]

No. C4-54/2009. 21st January 2009.

Sealed competitive tenders are invited for the supply of Tools and Equipments for Health Sanitory Inspector Trade of ITI, Chennerkara.

Name of items—Ventilation & Sewerage System and Treatment plant.

Cost of tender form :

Original—Rs. 169+12.5% VAT.

Duplicate—Rs. 113+12.5% VAT.

Last date of sale of tender form—21-2-2009.

Last date and time of receipt of tender—

28-2-2009, 2 p. m.

Date and time of opening of tender—

28-2-2009, 3 p. m.

The cost of tender form will be accepted only by cash or money order. The tender should be superscribed with tender number and date and addressed to the Principal, ITI, Chenneerkara, Pathanamthitta. Late tenders will not be accepted. One percent of the total cost quoted should be enclosed as E.M.D. and a validity period of 3 months from the date of opening of the tenders should be offered, otherwise the tenders will be rejected. Tenders in original should be accompanied with preliminary agreement in Kerala Stamp Paper worth Rs. 50 otherwise the tenders will not be considered. Stamp Paper will be forwarded to the firm outside Kerala if required, by remitting Rs. 75 separately by Money Order (Rs. 25 is needed intended to cover. postage and incidental expenses). Tender forms are not transferable.

വ്യാവസായിക പരിശീലന വകുപ്പിന്റെ കീഴിൽ പ്രവർത്തിക്കുന്ന ചെന്നീർക്കര എെ. ടി. എെ. യിലെ ഹെൽത്ത് സാനിറ്ററി ഇൻസ്പെക്ടർ ട്രേഡിലേക്ക് താഴെക്കാണുന്ന ടൂൾസ് ആന്റ ് എക്യുപ്മെൻസ് വിതരണം ചെയ്യാൻ താൽപ്പര്യമുള്ള സ്ഥാപനങ്ങളിൽ നിന്നും മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

ഇനം—വെന്റ ിലേഷൻ ആന്റ ് സിവറേജ് സിസ്റ്റം ട്രീറ്റ്മെന്റ ് πാന്റ ്.

ദർഘാസ് ഫോറത്തിന്റെ വില :

ഒറിജിനൽ—രൂപ 169 + 12.5% വാറ്റ്. ഡ്യൂπിക്കേറ്റ്—രൂപ 113 + 12.5% വാറ്റ്.

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതി—

21-2-2009.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—28-2-2009, 2 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—28-2-2009, 3 മണി.

ദർഘാസ് വില പണമായിട്ടോ മണിയോർഡറായിട്ടോ മാത്രമേ സ്വീകരിക്കുകയുള്ളൂ. ദർഘാസ് നമ്പർ, തീയതി എന്നിവ രേഖപ്പെടുത്തി മുദ്രവച്ച കവറുകൾ പ്രിൻസിപ്പാൾ, എെ. ടി. എെ., ചെന്നീർക്കര, പത്തനംതിട്ട എന്ന വിലാസത്തിൽ അയയ്ക്കേ≠താണ്. താമസിച്ചു ലഭിക്കുന്ന ദർഘാസുകൾ സ്വീകരിക്കുന്നതല്ല. ഒറിജിനൽ ദർഘാസ് പ്രമാണത്തോടൊപ്പം ആകെ വിലയുടെ ഒരു ശതമാനം നിരതദ്രവ്യവും 50 രൂപ (അമ്പത് രുപ മാത്രം) വിലയുള്ള കേരള സർക്കാർ മുദ്രപ്പത്രത്തിൽ പ്രാഥമിക കരാർ പത്രവും ഉ≠ായിരിക്കേ≠താണ്. ദർഘാസ് തുറക്കുന്ന തീയതി മുതൽ മൂന്ന് മാസം വരെ വില നിരക്ക് പ്രാബല്യത്തിൽ ഉ≠ായിരിക്കണം. അല്ലാത്തപക്ഷം ദർഘാസുകൾ പരിഗണിക്കുന്നതല്ല. കേരളത്തിന് പുറത്തുള്ള കമ്പനികൾക്ക് മുദ്രപ്പത്രം ആവശ്യമു ≠െങ്കിൽ 75 രൂപ മണിഓർഡർ ആയി അയച്ചുതന്നാൽ ഈ ആഫീസിൽനിന്നും മുദ്രപ്പത്രം വാങ്ങി അയച്ചു തരുന്നതാണ്. (മണിയോർഡർ മാത്രമേ സ്വീകരിക്കുകയുള്ളൂ.) ദർഘാസ് പ്രമാണം കൈമാറ്റം ചെയ്യാൻ പാടുള്ളതല്ല.

SCHEDULE

Sl. Description of Items Quantity No.

1 Ventilation (dynamic type model) 1 No. (a) 6mm plywood cabin the 80cm x 200cm door opening and 45cm x 30cm Ventilator Cabin size 1.5m x 1.5m x 2.5m 1 No. Exhaust fan 300mm in size 1 ,, 2 Sewarage system and Treatment plant 1 ,, (Static type Model) (a) 6mm marine plywood tank . ,, 30cm x 30cm x 45cm 2 Nos.

,, 30cm x 20cm x 20cm 3 ,, 30cm x 45cm x 45cm 1 No. 60cm x 20cm x 45cm 1 ,, 30cm x 20cm x 45cm 1 ,, 30cm x 20cm x 20cm 2 Nos. (b) PVC Pipe 1" diametre 2 Metre 1.5" diametre 2 ,, 2" diametre 2 ,,

(2)

[C4/02/09]

No. C4-55/2009. 21st January 2009.

Sealed competitive tenders are invited for the supply of Tools and Equipments for Health Sanitory Inspector Trade of ITI, Chenneerkara.

Name of Items—Water Purification Plant and Waste Disposal Unit.

Cost of tender form :

Original—Rs. 450+12.5% VAT.

Duplicate—Rs. 225+12.5% VAT.

Gaz. No. 8/2009/DTP (Stores).

Last date of sale of tender form—21-2-2009.

Last date and time of receipt of tender—

28-2-2009, 2 p. m.

Date and time of opening of tender—

28-2-2009, 3 p. m.

The cost of tender form will be accepted only by cash or money order. The tender should be superscribed with tender number and date and addressed to the Principal, ITI, Chenneerkara, Pathanamthitta. Late tenders will not be accepted. One percent of the total cost quoted should be enclosed as E.M.D. and a validity period of 3 months from the date of opening of the tenders should be offered, otherwise the tenders will be rejected. Tenders in original should be accompanied with preliminary agreement in Kerala Stamp Paper worth Rs. 50 otherwise the tenders will not be considered. Stamp Paper will be forwarded to the firms outside kerala if required by remitting Rs. 75 separately by money order. (Rs. 25 is intended to cover, postage and incidental expenses). Tender forms are not transferable.

വ്യാവസായിക പരിശീലന വകുപ്പിന്റെ കീഴിൽ പ്രവർത്തിക്കുന്ന ചെന്നീർക്കര എെ. ടി. എെ-യിലെ ഹെൽത്ത് സാനിറ്ററി ഇൻസ്പെക്ടർ ട്രേഡിലേക്ക് താഴെക്കാണുന്ന ടൂൾസ് ആന്റ ് എക്യുപ്മെൻസ് വിതരണം ചെയ്യാൻ താൽപ്പര്യ മുള്ള സ്ഥാപനങ്ങളിൽ നിന്നും മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

ഇനം—വാട്ടർ പ്യൂരിഫിക്കേഷൻ πാന്റ ് ആന്റ ് വേസ്റ്റ് ഡിസ്പോസൽ യൂണിറ്റ്.

ദർഘാസ് ഫോറത്തിന്റെ വില :

ഒറിജിനൽ—രൂപ 450 + 12.5% വാറ്റ്. ഡ്യൂπിക്കേറ്റ്—രൂപ 225 + 12.5% വാറ്റ്.

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതി—

21-2-2009.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—28-2-2009, 2 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—

28-2-2009, 3 മണി.

ദർഘാസ് വില പണമായിട്ടോ മണിയോർഡറായിട്ടോ മാത്രമേ സ്വീകരിക്കുകയുള്ളു. ദർഘാസ് നമ്പർ, തീയതി എന്നിവ രേഖപ്പെടുത്തി മുദ്രവച്ച കവറുകൾ പ്രിൻസിപ്പാൾ, എെ. ടി. എെ., ചെന്നീർക്കര, പത്തനംതിട്ട എന്ന വിലാസത്തിൽ അയയ്ക്കേ≠താണ്. താമസിച്ചു ലഭിക്കുന്ന ദർഘാസുകൾ സ്വീകരിക്കുന്നതല്ല. ഒറിജിനൽ ദർഘാസ് പ്രമാണത്തോടൊപ്പം ആകെ വിലയുടെ ഒരു ശതമാനം നിരതദ്രവ്യം 50 രൂപ വിലയുള്ള കേരള സർക്കാർ മുദ്രപ്പത്രത്തിൽ പ്രാഥമിക കരാർ പത്രവും ഉ≠ായിരിക്കേ≠താ ണ്. ദർഘാസ് തുറക്കുന്ന തീയതി മുതൽ മൂന്ന് മാസം വരെ വില നിരക്ക് പ്രാബല്യത്തിൽ ഉ≠ായിരിക്കണം. അല്ലാത്ത പക്ഷം ദർഘാസുകൾ പരിഗണിക്കുന്നതല്ല. കേരളത്തിനു പുറത്തുള്ള കമ്പനികൾക്ക് മുദ്രപ്പത്രം ആവശ്യമു≠െങ്കിൽ 75 രൂപ മണി ഓർഡർ ആയി അയച്ചുതന്നാൽ ഈ ആഫീസിൽനിന്നും മുദ്രപ്പത്രം വാങ്ങി അയച്ചുതരുന്നതാണ്. (മണിയോർഡർ മാത്രമേ സ്വീകരിക്കുകയുള്ളൂ.) ദർഘാസ് പ്രമാണം കൈമാറ്റം ചെയ്യാൻ പാടുള്ളതല്ല.

SCHEDULE

Sl. Description of Items Quantity No.

1 Water Purification Plant (Desk Top static model 1 No. with following accessories

(a) 4mm thick glass tank 45cmx300cmx30cm 2 Nos.

(b) ,, 20cmx20cmx30cm 1 No. (c) ,, 60cmx30cmx30cm 1 No. (d) Flexible tube 15mm dia (white colour) 1.5 m. (e) PVC Flexible pipe 20 mm dia 1.5 m (f) PVC hollow cylinder (Model as 1 No. chlorination Cylinder-45cm long)

2 Waste Disposal Unit–1 No.

(a) G. I. hollow cylinder—1.5 mm thick, 1 No. 30cm dia 60 cm height with including feed door, grating and ash door etc. (b) Hard wood plat form around

the cylinder, 20cm thick, 60 cm dia.

(c) G.I. trumeated cone above the hollow 1 No. cylinder 1.5 mm thick, 30 cm to 7.5 cm dia and 30 mm height.

(d) G. I. chimminey with top cover 1.5 mm thick 7.5 cm dia, 50 cm height.

(3)

[C4/03/09]

No. C4-56/2009. 21st January 2009.

Sealed competitive tenders are invited for the supply of Sanitory Latrin Equipments for Health Sanitory Inspector Trade of ITI, Chenneerkara.

Cost of tender form :

Original—Rs. 169+12.5% VAT.

Duplicate—Rs. 113+12.5% VAT.

Last date of sale of tender form—21-2-2009.

Last date and time of receipt of tender from—

28-2-2009, 2 p. m.

Date and time of opening of tender—

28-2-2009, 3 p. m.

The cost of tender form will be accepted only by cash or money order. The tender should be superscribed with tender number and dates and addressed to the Principal, ITI, Chenneerkara, Pathanamthitta. Late tenders will not be accepted. One per cent of the total cost quoted should be enclosed as E.M.D. and a validity period of 3 months from the date of opening of the tenders should be offered, otherwise the tenders will be rejected. Tenders in original should be accompanied with preliminary agreement in Kerala Stamp Paper worth Rs. 50. otherwise the tenders will not be considered. Stamp Paper will be forwarded to the firm outside Kerala if required by remitting Rs. 75 separately by money order (Rs. 25 is intended to cover, postage and incidental expenses). Tender forms are not transferable.

വ്യാവസായിക പരിശീലന വകുപ്പിന്റെ കീഴിൽ പ്രവർത്തിക്കുന്ന ചെന്നീർക്കര എെ. ടി. എെ. യിലെ ഹെൽത്ത് സാനിറ്ററി ഇൻസ്പെക്ടർ ട്രേഡിലേക്ക് സാനിറ്ററി ലാട്രിൻ എക്യുപ്മെൻസ് വിതരണം ചെയ്യാൻ താൽപ്പര്യമുള്ള സ്ഥാപനങ്ങളിൽ നിന്നും മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചു കൊള്ളുന്നു.

ദർഘാസ് ഫോറത്തിന്റെ വില :

ഒറിജിനൽ—രൂപ 169 + 12.5% വാറ്റ്. ഡ്യൂπിക്കേറ്റ്—രൂപ 113 + 12.5% വാറ്റ്.

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതി—

21-2-2009.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—28-2-2009, 2 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—28-2-2009, 3 മണി.

ദർഘാസ് വില പണമായിട്ടോ മണിയോർഡറായിട്ടോ മാത്രമേ സ്വീകരിക്കുകയുള്ളൂ. ദർഘാസ് നമ്പർ, തീയതി എന്നിവ രേഖപ്പെടുത്തി മുദ്രവച്ച കവറുകൾ പ്രിൻസിപ്പാൾ, എെ. ടി. എെ., ചെന്നീർക്കര, പത്തനംതിട്ട എന്ന വിലാസത്തിൽ അയയ്ക്കേ≠താണ്. താമസിച്ചു ലഭിക്കുന്ന ദർഘാസുകൾ സ്വീകരിക്കുന്നതല്ല. ഒറിജിനൽ ദർഘാസ് പ്രമാണത്തോടൊപ്പം ആകെ വിലയുടെ ഒരു ശതമാനം നിരതദ്രവ്യവും 50 രൂപ വിലയുള്ള കേരള സർക്കാർ മുദ്രപ്പത്രത്തിൽ പ്രാഥമിക കരാർ പത്രവും ഉ≠ായിരിക്കേ≠താണ്. ദർഘാസ് തുറക്കുന്ന തീയതി മുതൽ മൂന്ന് മാസം വരെ വില നിരക്ക് പ്രാബല്യത്തിൽ ഉ≠ായിരിക്കണം. അല്ലാത്തപക്ഷം ദർഘാസുകൾ പരിഗണിക്കുന്നതല്ല. കേരളത്തിന് പുറത്തുള്ള കമ്പനികൾക്ക് മുദ്രപ്പത്രം ആവശ്യമു≠െങ്കിൽ 75 രൂപ മണി ഓർഡർ ആയി അയച്ചുതന്നാൽ ഈ ആഫീസിൽനിന്നും മുദ്രപ്പത്രം വാങ്ങി അയച്ചുതരുന്നതാണ്. (മണിയോർഡർ മാത്രമേ സ്വീകരിക്കുകയുള്ളൂ). ദർഘാസ് പ്രമാണം കൈമാറ്റം ചെയ്യാൻ പാടുള്ളതല്ല.

SCHEDULE

Description of Item Quantity Sl. No.

(1) (2)

(3) 1 Sanitary Latrin (Dynamic type Model) 1 No. with following accessories

(a) PVC septic tank with 3 compartment 1 No. 100 litter capacity (b) Soak pit 45 cm.diameter 75 cm height 1 No. (c) U-type water closet with flush tank 1 No. operated with foot rest (standard size) (d) Q-trap23 (1) (2)

(3) (e) PVC pipe 10 cm dia meter 3 meters (f) PVC Tee 1 No. (g) PVC Vent pipe with top cover 50 mm 1 No. dia 1.5 long

(Sd.) I.T.I., Chenneerkara, Pathanamthitta. Principal.

SHORT TENDER NOTICES

(1)

No. A2-125/2009. 22nd January 2009.

Sealed tenders are invited for the supply of Revit- Autocadd inbuilt with Architectural desk top (5 user)—1 No. for Draughtsman Civil trade in connection with Employment and Finishing School Course 2008-09 at Government ITI Areacode under Industrial Training Department.

Cost of tender form :

Original—Rs. 700.

Duplicate—Rs. 300.

Last date and time of sale of tender forms—

27-2-2009, 3 p. m.

Last date and time of receipt of tender forms—

28-2-2009, 3 p. m.

Date and time of opening of tenders—

28-2-2009, 4 p. m.

TERMS AND CONDITIONS

Tenders should be superscripted with tender number and date and addressed to the Principal, ITI Areacode Malappuram District. Late tenders will not be accepted. The tenders will be opened at the time and date given above in the presents of tenderers or their authorized representatives who may be present at that time.

Intending tenderers may on application to the principal obtain the requisite tender forms on which tender should be submitted. Application for tender forms should be accompanied by a cash remittance of price of the form in favour of the Principal, Govt. ITI Areacode, which is not refundable under any cirucmstances. Those who wish to get the tender forms by post should send an extra amount of Rs.10 by way of money order. Tender forms are not transferable.

Drafts, cheques, postage stamps, postal orders etc. will not be accepted towards the cost of form and the form will not be send by VPP. Duplicate tender form will be issued on remittance of the prescribed cost.

Kerala stamp paper worth Rs. 50 (Rupees fifty only) is required for executing the agreement along with the tender. Tender will be supplied to firms outside Kerala on remittance of Rs. 60 (Rupees sixty only) separately by Money Order Rs. 10 is intended to cover postage and incidental expenses.

Along with tender an amount which is not less than one per cent of the tender value should be enclosed as security deposit. Security deposit should be in the form of Demand Draft in favour of the Prncipal, ITI Areacode, Malappuram District.

വ്യാവസായിക പരിശീലന വകുപ്പിന്റെ കീഴിലുള്ള അരീക്കോട് എെ. ടി. എെ. യിലെ എംπോയ്മെന്റ ് ആന്റ ് ഫിനിഷിംഗ് സ്കൂൾ കോഴ്സിന്റെ ഭാഗമായി ഡി/സിവിൽ ട്രേഡിലേക്കാവശ്യമായ റിവിറ്റ് ഓട്ടോകാഡ് ഇൻ ബിൽറ്റ് വിത്ത് ആർക്കിടെക്ച്വറൽ ടെസ്ക് ടോപ്പ് (5 യൂസർ)—1 എണ്ണം വിതരണം ചെയ്യുന്നതിന് താല്പര്യമുള്ളവരിൽ നിന്നും മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിക്കുന്നു.

ദർഘാസ് ഫോറത്തിന്റെ വില :

അസൽ— രൂപ 700.

പകർപ്പ്— രൂപ 300.

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും—27-2-2009, 3 മണി.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—28-2-2009, 3 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—

28-2-2009, 4 മണി.

ദർഘാസുകളുടെ കവറിന് പുറത്ത് നമ്പരും തീയതിയും എഴുതേ≠താണ്. ദർഘാസുകൾ പ്രിൻസിപ്പാൾ, വ്യവസായിക പരിശീലന വകുപ്പ്, എെ.ടി.എെ. അരീക്കോട്, മലപ്പുറം എന്ന വിലാസത്തിൽ അയയ്ക്കേ≠താണ്. താമസിച്ച് ലഭിക്കുന്ന ദർഘാസുകൾ ഒരു കാരണവശാലും സ്വീകരിക്കുന്നതല്ല. ദർഘാസുകൾ നി›ിത സമയത്ത് ഹാജരായിരിക്കുന്ന ദർഘാസു കാരുടെ സാന്നിദ്ധ്യത്തിൽ തുറക്കുന്നതാണ്.

ദർഘാസ് പ്രമാണത്തിന് നി›ിത തുക അടച്ച് അപേക്ഷിക്കേ≠താണ്. ദർഘാസ് വില എെ.ടി.എെ. അരീക്കോട്, പ്രിൻസിപ്പാളിന് മണി ഓർഡർ ആയി അയയ്ക്കാ വുന്നതാണ്. ഡ്രാഫ്റ്റ്, ചെക്ക്, പോസ്റ്റൽ ഓർഡർ എന്നീ രീതികളിൽ ദർഘാസ് വില സ്വീകരിക്കുന്നതല്ല. ദർഘാസ് പ്രമാണം വി. പി. പി. ആയി ലഭിക്കുന്നതല്ല. ദർഘാസ് പ്രമാണം തപാൽ വഴി ലഭിക്കാൻ 10 രൂപ കൂടുതൽ എെ. ടി. എെ. അരീക്കോട്, പ്രിൻസിപ്പാളിന്റെ പേരിൽ മണി ഓർഡർ ആയി അടച്ച് അപേക്ഷിക്കേ≠താണ്.

ദർഘാസ് പ്രമാണത്തിൽ കൊടുത്തിട്ടുള്ള കരാർ മാതൃകയിൽ 50 രൂപയുടെ കേരള സർക്കാർ മുദ്രപത്രത്തിൽ കരട് ഒപ്പിട്ട് ദർഘാസിനൊപ്പം സമർപ്പിക്കേ≠താണ്. കേരളത്തിന് പുറത്തുള്ള ദർഘാസുകൾക്ക് മുദ്രപത്രം ദർഘാസിനൊപ്പം ആവശ്യമു≠െങ്കിൽ 60 രൂപ അടച്ച് അപേക്ഷിക്കേ≠താണ്.

ദർഘാസുകൾക്കൊപ്പം കരാർ തുകയുടെ 1%-ൽ കുറയാത്ത തുക നിരതദ്രവ്യമായി എെ. ടി. എെ. അരീക്കോട് പ്രിൻസിപ്പാളിന്റെ പേരിൽ മാറാവുന്ന ഡ്രാഫ്റ്റായി അടക്കം ചെയ്തിരിക്കേ≠താണ്.

ദർഘാസ് പ്രമാണങ്ങൾ കൈമാറ്റം ചെയ്യാവുന്നതല്ല. ഡ്യൂപ്ളിക്കേറ്റ് ദർഘാസ് പ്രമാണം ആവശ്യമുള്ളവർ നി›ിത തുക അടയ്ക്കേ≠താണ്. ദർഘാസ് വിലയായി അടച്ച തുക യാതൊരു കാരണവശാലും തിരിച്ച് നല്കുന്നതല്ല.

(2)

No. A2-127/2009. 22nd January 2009.

Sealed tenders are invited for the supply of Tools for Electric Trade in connection with Employment and Finishing School Course 2008-09 at Government ITI Areacode under Industrial Training Department.

SCHEDULE

TERMS AND CONDITIONS

Tenders should be superscripted with Tender number and date and addressed to the Principal, ITI Areacode Malappuram District. Late tenders will not be accepted. The tenders will be opened at the time and date given above in the presents of tenderers or their authorized representatives who may be present at that time.

Sl. No. Description of Items Quantity

(Nos.)

1 Combination players, 200 mm. insulated 10 2 Screw Driver, 200 mm 10 3 Terminal Screw Driver 10 4 Neon Tester, 500v Pencil bit 10 5 Knife DB, Electrician 10 6 Hammer ball peen 0.25 Kg 10 7 Firmers chisel 12 mm 10 8 Rached brace 6mm Capacity 10 9 Rached bit 4 mm and 6 mm 10 10 Hacksaw frame adjustable

200 mm to 300 mm 10 11 Steel rule 300 mm 10 12 Multimeter 0-1000 m ohm

25 to 500V 2 13 Tong Tester 1 14 AC Voltmeter MI 0-500V 1 15 AC Ammeter MI 0.5A 1 16 Merger 500V 1 17 Motor Generator set with

panel board 1 18 Motor AC three phase

440V 5HP with starter 1 Cost of tender form :

Original—Rs. 450.

Duplicate—Rs. 200.

Last date and time of sale of tender form—

27-2-2009, 3 p. m.

Last date and time of receipt of tender form—

28-2-2009, 3 p. m.

Date and time of opening of tenders—

28-2-2009, 4 p. m.

Intending tenderers may on application to the principal obtain the requisite tender forms on which tender should be submitted. Application for tender forms should be accompanied by a cash remittance of price of the form in favour of the Principal, Govt. ITI Areacode which is not refundable under any cirucmstances. Those who wish to get the tender forms by post should send an extra amount of Rs.10 by way of Money Order. Tender forms are not transferable.

Drafts, cheques, postage stamps, postal orders etc. will not be accepted towards the cost of form and the form will not be send by VPP. Duplicate tender form will be issued on remittance of the prescribed cost.

Kerala stamp paper worth Rs. 50 is required for executing the agreement along with the tender. Tender will be supplied to firms outside Kerala on remittance of Rs. 60 separately by Money Order Rs. 10 is intended to cover postage and incidental expenses.

Along with tender an amount which is not less than one percent of the Tender value should be enclosed as security deposit. Secruity deposit should be in the form of Demand Draft in favour of the Prncipal, ITI Areacode, Malappuram District.

വ്യവസായിക പരിശീലന വകുപ്പിന്റെ കീഴിലുള്ള അരീക്കോട് എെ. ടി. എെ.-യിലെ എംπോയ്മെന്റ ് ആന്റ ് ഫിനി ഷിംഗ് സ്കൂൾ കോഴ്സിന്റെ ഭാഗമായി ഇലക്ട്രീഷ്യൻ ട്രേഡിലേക്കാവശ്യമായ വിവിധയിനം ടൂൾസുകൾ വിതരണം ചെയ്യുന്നതിന് താല്പര്യമുള്ളവരിൽ നിന്നും മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിക്കുന്നു.

സാമഗ്രികൾ എണ്ണം ക്രമ നമ്പർ

(1)

(2)

(3) 1 കോമ്പിനേഷൻ πെയേഴ്സ് 200 എം. എം.

ഇൻസുലേറ്റഡ്

10 2 സ്ക്രൂഡ്രൈവർ, 200 എം. എം. 10 3 ടെർമിനൽ സ്ക്രൂഡ്രൈവർ 10 4 നിയോൺ ടെസ്റ്റർ, 500 വോൾട്ട്

പെൻസിൽ ബിറ്റ്

10 5 നൈഫ് ഡി ബി, ഇലക്ട്രീഷ്യൻ 10 6 ഹാമർ ബാൾപീൻ 0.25 കിലോ 10 7 ഫേമേഴ്സ് ചിസൽ 12 എം. എം. 10 8 റേച്ച്ഡ് ബ്രെയ്സ് 6 എം. എം.

കപ്പാസിറ്റി

9 റേച്ച്ഡ് ബിറ്റ് 4 എം. എം.

10 ആന്റ ് 6 എം. എം.

10 10 ഹാക്സാ ഫ്രെയിം അഡ്ജസ്റ്റബിൾ

200 എം. എം. മുതൽ 300 എം. എം. വരെ 1025 (1)

(2)

(3) 11 സ്റ്റീൽ റൂൾ 300 എം. എം.

10 12 മൾട്ടിമീറ്റർ 0-1000 മില്ലി ഓം 25-500 വോൾട്ട് 2 13 ടംഗ് ടെസ്റ്റർ

1 14 എ. സി. വോൾട്ട് മീറ്റർ എം. എെ. 0-500 വോൾട്ട് 1

1 15 എ. സി. അമ്മീറ്റർ എം. എെ. 0-5 എ 1 16 മെർജർ 500V 17 മോട്ടോർ ജനറേറ്റർ സെറ്റ് വിത്ത്

പാനൽ ബോർഡ്

1 18 മോട്ടോർ എ. സി. ത്രീ ഫേസ് 440V 5എച്ച്. പി. 1 വിത്ത് സ്റ്റാർട്ടർ

ദർഘാസ് ഫോറത്തിന്റെ വില :

അസ്സൽ—രൂപ 450. പകർപ്പ്—രൂപ 225.

ദർഘാസ് വിൽക്കുന്ന അവസാന തീയതിയും സമയവും—27-2-2009, 3 മണി.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—28-2-2009, 3 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—

28-2-2009, 4 മണി.

ദർഘാസുകളുടെ കവറിന് പുറത്ത് നമ്പരും തീയതിയും എഴുതേ≠താണ്. ദർഘാസുകൾ പ്രിൻസിപ്പാൾ, വ്യാവസായിക പരിശീലന വകുപ്പ്, എെ.ടി.എെ., അരീക്കോട്, മലപ്പുറം എന്ന വിലാസത്തിൽ അയയ്ക്കേ≠താണ്. താമസിച്ച് ലഭിക്കുന്ന ദർഘാസുകൾ ഒരു കാരണവശാലും സ്വീകരിക്കുന്നതല്ല. ദർഘാസുകൾ നി›ിത സമയത്ത് ഹാജരായിരിക്കുന്ന ദർഘാസുകാരുടെ സാന്നിദ്ധ്യത്തിൽ തുറക്കുന്നതാണ്.

ദർഘാസ് പ്രമാണത്തിന് നി›ിത തുക അടച്ച് അപേക്ഷിക്കേ≠താണ്. ദർഘാസ് വില എെ.ടി.എെ. അരീക്കോട് പ്രിൻസിപ്പാളിന് മണിഓർഡർ ആയി അയയ്ക്കാവു ന്നതാണ്. ഡ്രാഫ്റ്റ്, ചെക്ക്, പോസ്റ്റൽ ഓർഡർ എന്നീ രീതികളിൽ ദർഘാസ് വില സ്വീകരിക്കുന്നതല്ല. ദർഘാസ് പ്രമാണം വി. പി. പി. ആയി ലഭിക്കുന്നതല്ല. ദർഘാസ് പ്രമാണം തപാൽ വഴി ലഭിക്കാൻ 10 രൂപ കൂടുതൽ എെ.ടി.എെ. അരീക്കോട് പ്രിൻസിപ്പാളിന്റെ പേരിൽ മണി ഓർഡർ ആയി അടച്ച് അപേക്ഷിക്കേ≠താണ്.

ദർഘാസ് പ്രമാണത്തിൽ കൊടുത്തിട്ടുള്ള കരാർ മാതൃകയിൽ 50 രൂപയുടെ കേരള സർക്കാർ മുദ്രപത്രത്തിൽ കരട് ഒപ്പിട്ട് ദർഘാസിനൊപ്പം സമർപ്പിക്കേ≠താണ്. കേരളത്തിന് പുറത്തുള്ള ദർഘാസുകൾക്ക് മുദ്രപത്രം ദർഘാസിനൊപ്പം ആവശ്യമു≠െങ്കിൽ 60 രൂപ അടച്ച് അപേക്ഷിക്കേ≠താണ്.

ദർഘാസുകൾക്കൊപ്പം കരാർ തുകയുടെ 1%-ൽ കുറയാത്ത തുക നിരതദ്രവ്യമായി എെ. ടി. എെ. അരീക്കോട് പ്രിൻസിപ്പാളിന്റെ പേരിൽ മാറാവുന്ന ഡ്രാഫ്റ്റായി അടക്കം ചെയ്തിരിക്കേ≠താണ്.

ദർഘാസ് പ്രമാണങ്ങൾ കൈമാറ്റം ചെയ്യാവുന്നതല്ല. ഡ്യൂപ്ളിക്കേറ്റ് ദർഘാസ് പ്രമാണം ആവശ്യമുള്ളവർ നി›ിത തുക അടയ്ക്കേ≠താണ്. ദർഘാസ് വിലയായി അടച്ച തുക യാതൊരു കാരണവശാലും തിരിച്ച് നൽകുന്നതല്ല.

(Sd.) Industrial Training Institute, Areacode, Malappuram. Principal.

Gaz. No. 8/2009/DTP (Stores).

IrrigatioIrrigatioIrrigatioIrrigatioIrrigation Departmentn Departmentn Departmentn Departmentn Department

പുനർ ദർഘാസ് പരസ്യം

നമ്പർ ഡി.3-846/2008(എ). 2009 ജനുവരി 28.

കേരള ഗവർണ്ണർക്കുവേ≠ി എക്സിക്യൂട്ടീവ് എഞ്ചിനീയർ മെക്കാനിക്കൽ ഡിവിഷൻ, ആലപ്പുഴ താഴെ പറയുന്ന സാമഗ്രികൾ സπൈ ചെയ്യുന്നതിൽ മൽസരസ്വഭാവമുള്ള മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

ദർഘാസ് നമ്പർ—8/ഇഇ/2008-09.

സാമഗ്രിയുടെ പേരും എണ്ണവും:

1. റ∫ർ മോൾഡ്ഡ് ഹെവിഡ്യൂട്ടി സക്ഷൻ ഹോസ്വിത്ത് റ∫ർ ഫ്ളാഞ്ച് എെ ഡി. 305 എം. എം. ഒ.ഡി 381 എം. എം. നീളം 2440 എം.

എം. (സാമ്പിൾ പ്രകാരം)—1

2. 2 ഡ്രഡ്ജർ റ∫ർ …ീവ് നീളം 475 എം. എം. എെ. ഡി. 260 എം. എം. ഒ. ഡി 311 എം. എം. (സാമ്പിൾ പ്രകാരം)—15

നിരതദ്രവ്യം—ക്വാട്ട് ചെയ്യുന്ന തുകയുടെ 1%

ദർഘാസ് പ്രമാണങ്ങളുടെ വില—രൂപ 400 + എസ്സ്. റ്റി.

ദർഘാസ് പ്രമാണങ്ങൾ എക്സിക്യൂട്ടീവ് എഞ്ചീനിയർ മെക്കാനിക്കൽ ഡിവിഷൻ ആലപ്പുഴയുടെ കാര്യാലയത്തിൽ നിന്ന് 20-2-2009 മുതൽ 28-2-2009 വരെ പ്രവർത്തി ദിവസങ്ങളിൽ രാവിലെ 11 മണിമുതൽ ഉച്ചയ്ക്ക് 1 മണിവരെ ലഭിക്കുന്നതാണ്.

ദർഘാസ് സ്വീകരിക്കുന്ന തീയതിയും സമയവും—

28-2-2009, 4 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—28-2-2009, 4.30 മണി.

കാലാവധി—15 ദിവസം

മറ്റു വ്യവസ്ഥകൾ

1. ദർഘാസ് പ്രമാണത്തിനുള്ള അപേക്ഷയോടൊപ്പം സമാന പ്രവർത്തികളിൽ പരിചയം കാണിക്കുന്ന സാക്ഷ്യ പത്രം ഹാജരാക്കേ≠താണ്.

2. ദർഘാസ് സംബന്ധിച്ച് ജലവിഭവ വകുപ്പിൽ നിലവിലുള്ള എല്ലാ വ്യവസ്ഥകളും ഈ ദർഘാസിനും ബാധകമാണ്.

3. നി›ിത സമയം കഴിഞ്ഞുലഭിക്കുന്ന ദർഘാസുകൾ സ്വീകരിക്കുന്നതല്ല.

4. പ്രമാണങ്ങൾ തപാലായി ആവശ്യമുള്ളവർ പ്രമാണ ത്തിന്റെ വിലയോടൊപ്പം 50 രൂപ കൂടി തപാൽ ചെലവിനായി അയയ്ക്കേ≠താണ്.

മെക്കാനിക്കൽ ഡിവിഷൻ, (ഒപ്പ്)

ആലപ്പുഴ. എക്സിക്യൂട്ടീവ് എഞ്ചിനീയർ.

Medical Education Department

TENDER NOTICE

No. C8/22350/2008/MCT. 2nd January 2009.

Sealed competitive tenders are invited for the supply of Journals for the Central Library of Medical College, Thiruvananthapuram.

Tenders should be superscribed as "C8/22350/08/ MCT-Journals for Central Library 2008-09". and addressed to the Principal, Medical College, Thiruvananthapuram, Pin-695 011. Details can be had from this office on working hours till 3.30 p. m.

Tender No.—171/2008.

Cost of tender form (inclusive Sales Tax):

Original—Rs. 450.

മണിയോർഡർ ആയോ സ്വീകരിക്കുന്നതാണ്. അല്ലാതെയുള്ള എല്ലാ അപേക്ഷകളും നിരസിക്കുന്നതാണ്. ഫോറത്തോടൊപ്പം മുദ്രപത്രങ്ങളോ മറ്റേതെങ്കിലും ഡോക്യുമെന്റുകളോ അയയ്ക്കാൻ ആവശ്യപ്പെട്ടുകൊ≠ുള്ളതും മേൽവിലാസം വ്യ‡ മല്ലാത്തതുമായ മണിയോർഡറുകൾ നിരസിക്കുന്നതാണ്. മണിയോർഡറുകൾവഴി ഫോറങ്ങൾ ആവശ്യപ്പെട്ടുകൊ≠ുള്ള അപേക്ഷകൾ ഈ ഓഫീസിൽ 24-2-2009-ന് മുൻപ് കിട്ടിയിരിക്കണം. താമസിച്ചു കിട്ടുന്ന മണിയോർഡറുകൾ നിരസിക്കുന്നതാണ്. ദർഘാസ് ഫോറം കൈമാറാൻ പാടില്ലാത്തതും ഒരിക്കൽ അടച്ച തുക തിരിച്ചു കിട്ടുന്നതുമല്ലാ ത്തതാണ്. താമസിച്ചു കിട്ടുന്ന ദർഘാസുകൾ യാതൊരു കാരണവശാലും സ്വീകരിക്കുന്നതല്ല. കൂടുതൽ വിവരങ്ങൾ പ്രവൃത്തി ദിവസങ്ങളിൽ ഈ ആഫീസിൽ നിന്നും ലഭിക്കുന്നതാണ്.

(Sd.) Medical College, Thiruvananthapuram. Principal.

Technical Education Department

Duplicate—Rs. 225.

Last date and time for sale of tender form—

2-3-2009, 3. 30 p. m.

Last date and time for receipt of tender form—

3-3-2009 at 2.30 p. m.

Date and time for opening of tender—3-3-2009 at 3 p. m.

SHORT TENDER NOTICE

No. P4-7837/2008/CS. 17th January 2009.

P4-7838/2008/CS. P4-7915/2008/E&C P4-8182/2008/CCF.

Sealed tenders are invited for the supply of the following equipments for the use of Various Departments of College of Engineering, Thiruvananthapuram.

Sl. No. Tender No. and Item

(1)

(2)

Computer Science and Engineering Department

Tender forms will be sent through post if required provided due amount with sufficient postage charges (Rs. 50) is sent by way of Money Order in favour of the Principal, Medical College, Thiruvananthapuram, Kerala State, Pin-695 011. Money Order should reach this Office on or before 24-2-2009. No other forms of remittance will be accepted.

തിരുവനന്തപുരം മെഡിക്കൽ കോളേജിലേ സെൻട്രൽ ലൈബ്രറിയിലേക്ക് ആവശ്യമായ ജേർണൽ വിതരണം ചെയ്യുന്നതിന് മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിക്കുന്നു. ദർഘാസുകൾ ദർഘാസ് നമ്പരോടുകൂടി നി›ിത തീയതിക്കുമുമ്പ് പ്രിൻസിപ്പാൾ, മെഡിക്കൽ കോളേജ്, തിരുവനന്തപുരം-695 011 എന്ന വിലാസത്തിൽ എത്തിച്ചിരിക്കേ≠താണ്.

ദർഘാസ് നമ്പർ-171/2008.

ദർഘാസ് ഫോറത്തിന്റെ വില (നികുതികൾ ഉൾപ്പെടെ):

അസ്സൽ—രൂപ 450. പകർപ്പ്—രൂപ 225.

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും—2-3-2009, 3.30 മണി.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും—3-3-2009, 2.30 മണി.

ദർഘാസ് ഫോറം തുറക്കുന്ന തീയതിയും സമയവും—

3-3-2009, 3 മണി.

ഫോറങ്ങൾ തപാലിൽ വേ≠വർ അയയ്ക്കുന്നതിനു വേ≠ തുക (രൂപ 50) അധികമായി അയയ്ക്കേ≠താണ്. ദർഘാസ് ഫോറത്തിന്റെ വില ഓഫീസിൽ നേരിട്ടോ 1 16/2008/P4/CS (1) External Portable Slim USB 2.0

Laptop DVD writer—3

(2) DVD Sata writer Dual Layer Box

Pack—4

(3) Slim size Usb Hard Disk Drive

160Gb/Grater—3

(4) RJ-45/RJ 12/RJ 11 Crimper—5 (5) Optical mouse with pad—5 (6) USB Multimedia keyboard—4 (7) 1 GB DDR RAM I/400 MHz—7 (8) Print Server-RJ 45 Network Speed

10/100 Mbps Printer—1 Interface: USB 1.1/grater (9) White board marker—40 2 17/2008/P4/CS (1) Cat 6 UTP Cable (300 mts/box)—

4 boxes

(2) Cat 6 KM8 modular jack with SMB and interface plate—40 (3) Patch Panel: Cat 6 Angular Patch

Panel—2

(4) RJ 45 to RJ 45 Patch Cords: Cat 6

Patch cords 1mtr—40

(5) RJ 45 to RJ 45 Patch Cords: Cat 6

Patch cords 2mtr—4027 (1)

(2)

(1)

(2)

(7) 1 ജി ബി ഡി ഡി ആർ റാം Electronics and Communication Engineering Department 3 18/2008/P4E&C Electronic Components (Various

items)

1/400 MHz —7

Central Computer Facility

4 19/2008/P4/CCF UPS Backup batteries—9 Nos.

EP-12-100, 100AH

12 volt SMF Battery

Cost of tender forms:

Original—Rs. 450.

Duplicate—Rs. 225.

By post —Rs. 490.

Last date and time of sale of tender form—

24-2-2009 at 2 p. m.

Last date and time of receipt of tender—25-2-2009 at 3 p. m.

Date and time of opening of tender—26-2-2009 at 11 a. m. for Sl.Nos. 1 and 2, 26-2-2009, 12 Noon for Sl. Nos. 3 and 4.

(8) പ്രിന്റ ് സെർവർ ആർ. ജെ 45 നെറ്റ് വർക്ക് സ്പീഡ് 10/100 എം. ബ ി . പ ി . എ സ ് . ്ര പ ി ന്റ ർ — 1 ഇന്റർഫെയ്സ്് യുഎസ്ബി 1.1/ ഗ്രേറ്റർ

(9) വൈറ്റ് ബോർഡ് മാർക്കർ—40 2 17/2008/പി4/സി.എസ.് (1) കാറ്റ് 6 യുടിപി കേബിൾ

(300 mts box) 4 ബോക്സസ് (2) കാറ്റ് 6 കെ എം 8 മോഡലുർ ജാക്ക് വിത്ത് എസ് എം ബി ആന്റ ് ഫേസ് πേറ്റ്-40

(3) പാച്ച് പാനൽ : കാറ്റ് 6 ആൻഗുലർ

പാച്ച് ചാനൽ-2

(4) ആർ. ജെ 45 റ്റു ആർ.ജെ. 45 പ ാ ച്ച ് േ ക ാ ഡ ് സ ് ക ാ റ്റ ് 6 പാച്ച്കോഡ്സ് : 1 മീറ്റർ-40 (5) ആർ ജെ 45 റ്റു ആർ ജെ 45 പാച്ച് കോഡ്സ് കാറ്റ് 6 പാച്ച് കോഡ്സ :് 2 മീറ്റർ-40

ഇലക്ട്രോണിക്സ് ആന്റ ് കമ്മ്യുണിക്കേഷൻ

ഡിപ്പാർട്ടുമെന്റ ്

3 1 8 / 2 0 0 8 / പ ി 4 / ഇ . ആ ന്റ ് സ ി — ഇ ല ക ് േ ്ര ട ാ ണ ി ക ് സ ്

കമ്പോണന്റ ്സ് (വിവിധ തരം) സെൻട്രൽ കമ്പ്യൂട്ടർ ഫെസിലിറ്റി

Intending tenderers may on application to the undersigned to obtain the requisite tender form on which tenders should be submitted. Application for the tender form should be accompanied by a remittance of above prices fixed for the same and which is non-refundable under any circumstances. The tender forms are not transferable. Cost of tender form is only acceptable by Money Order or cash remittance to this office. As per condition the tenderer should send along with his tender an agreement executed and signed in Kerala Stamp Paper value of Rs. 50 and Earnest Money Deposit 1% of the total cost of articles tendered. Tenders without agreement, tender form and Earnest Money Deposit will be rejected.

ഗവൺമെന്റ ് എൻജിനീയറിംഗ് കോളേജിലെ വിവിധ എൻജിനീയറിംഗ് വകുപ്പുകളിലേക്ക് ആവശ്യമായ സാധനസാമഗ്രമികൾ വിതരണം ചെയ്യാൻ താൽപര്യമുള്ള സ്ഥാപനങ്ങളിൽ നിന്നും മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

ക്രമ നമ്പർ ദർഘാസ് നമ്പരും ഇനവും

(1)

(2)

4 19/2008/പി4/സി സി എഫ്—യുപിഎസ് ബാക്ക് അപ് ബാറ്ററീസ്-9 എണ്ണം (EP-12-100, 100 AH 12 volt SMF Battery) ദർഘാസ് ഫാറത്തിന്റെ വില :

ഒറിജിനൽ—450 രൂപ ഡ്യൂപ്ളിക്കേറ്റ്—225 രൂപ

തപാൽ വഴി—490 രൂപ.

ദർഘാസ് ഫോറത്തിന്റെ വിൽപ്പനയുടെ അവസാന തീയതിയും സമയവും—24-2-2009, 2 മണി.

ദർഘാസ് സ്വീകരിക്കുന്ന അവസാന തീയതിയും സമയവും— 25-2-2009, 3 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും— ക്രമ നമ്പർ 1-നും 2-നും 26-2-2009, 11 മണി., ക്രമനമ്പർ 3-നും, 4-നും 26-2-2009, 12 മണി.

കമ്പ്യൂട്ടർ സയൻസ് ആന്റ ് എൻജിനീയറിംഗ്

ഡിപ്പാർട്ടുമെന്റ ്

1 16/2008/പി4/സി.എസ് (1) എക്സ്റ്റേണൽ പോർട്ടബിൾ …ിം യു. എസ്. ബി 2.0 ലാപ്ടോപ്പ് ഡി.വി.ഡി., റൈറ്റർ—3

(2) ഡി. വി. ഡി. സാറ്റാ റൈറ്റർ ഡ്യൂവൽ

ലേയർ ബോക്സ് പാക്ക്—4

(3) …ിം സൈസ് യു .എസ്. ബി. ഹാർഡ് ഡിസ്ക് ഡ്രൈവ് 160 ജി. ബി/ഗ്രേറ്റർ—3

(4) ആർ. ജെ 45/ആർ. ജെ 12/ആർ. ജെ.

11/ക്രിംപർ—3

(5) ഓപ്റ്റിക്കൽ മൗസ് വിത്ത് പാഡ്—5 (6) യൂ എസ്. ബി മൾട്ടി മീഡിയ

കീബോർഡ്—4

ദർഘാസ് വില പണമായിട്ടോ മണിയോർഡർ ആയിട്ടോ മാത്രമേ സ്വീകരിക്കുകയുള്ളൂ. ദർഘാസ് നമ്പർ, തീയതി എന്നിവ രേഖപ്പെടുത്തി, മുദ്രവച്ച കവറുകൾ പ്രിൻസിപ്പാൾ, എൻജിനീയറിംഗ് കോളേജ്, തിരുവനന്തപുരം-16 എന്ന മേൽവിലാസത്തിൽ അയയ്ക്കേ≠താണ്. താമസിച്ചു ലഭിക്കുന്ന ദർഘാസുകൾ പരിഗണിക്കുന്നതല്ല. ഒറിജിനൽ ദർഘാസ് പ്രമാണത്തോടൊപ്പം ആകെ വിലയുടെ 1 % നിരതദ്രവ്യവും 50 രൂപ വിലയുള്ള കേരള മുദ്രപത്രത്തിൽ പ്രാഥമിക കരാർ പത്രവും ഉ≠ായിരിക്കേ≠താണ്.

ദർഘാസ് തുറക്കുന്ന തീയതി മുതൽ ആറു മാസംവരെ വില നിരക്കിന് പ്രാബല്യം ഉ≠ായിരിക്കേ≠താണ്. ദർഘാസ് പ്രമാണം കൈമാറ്റം ചെയ്യാൻ പാടില്ലാത്തതാണ്.

Govt. College of Engineering, (Sd.) Thiruvananthapuram. Principal.

TENDER NOTICES

(1)

No. A3-840/2008. 19th January 2009.

Sealed tenders are invited for the supply of Lab Equipments in Electronic Branch of Government Polytechnic College, Nedumkandam.

The tender should be superscribed No. A3-840/2008 supply of Electronic Branch Equipments in the Electronics Department of this institution and addressed with the Principal, Government Polytechnic College, Nedumkandam before 3 p.m. on 25-2-2009. Late tenders will not be accepted. Tender will be opened at 3 p. m. on 26-2-2009 in the presence of the tenderers or their representatives who may be present at that time.

Inviting tenders may on application to Principal obtain the requisite tender form on which tender should be submitted. Application for the tender form should be accompanied by a cash remittance of Rs. 400 + VAT which is fixed for a form and which is not refundable under any circumstances. Duplicate tender forms will available for cost of Rs. 200+ VAT. The tender forms are not transferable, sale will be closed on 25-2-2009 at 2 p.m. Cheque, Postage Stamps will not be accepted towards the cost of form nor will the form be sent by V.P.P. Earnest Money Deposit @ 1% of total cost of Cotton items by means of Demand Draft in favour of Principal, Government Polytechnic College, Nedumkandam.

P. A. C.—Rs. 1,96,450.

നെടുങ്ക≠ം ഗവൺമെന്റ ് പോളിടെക്നിക് കോളേജിലെ ഇലക്ട്രോണിക്സ് ബ്രാഞ്ചിലേക്ക് ഉപകരണങ്ങൾ വിതരണം ചെയ്യുന്നതിനായി മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

കവറിനുമുകളിൽ ''നമ്പർ എ3-840/2008 നെടുങ്ക≠ം ഗവൺമെന്റ ് പോളിടെക്നിക് കോളേജിൽ ഇലക്ട്രോണിക്ക് ലാബ് ഉപകരണങ്ങൾ വിതരണം ചെയ്യുന്നതിനായി'' എന്നെഴുതിയ ദർഘാസ് അടക്കംചെയ്ത കവർ പ്രിൻസിപ്പാൾ, ഗവൺമെന്റ ് പോളിടെക്നിക് കോളേജ്, നെടുങ്ക≠ം-685 553 എന്ന വിലാസത്തിൽ 25-2-2009, 3 മണിക്കുമുമ്പായി ലഭിച്ചിരിക്കണം. വൈകിക്കിട്ടുന്ന ദർഘാസുകൾ യാതൊരു കാരണവശാലും സ്വീകരിക്കുന്നതല്ല. ദർഘാസുകൾ 26-2-2009 പകൽ 3 മണിക്ക് ഹാജരായ ദർഘാസുകാരുടെയോ അവർ അധികാരപ്പെടുത്തിയ പ്രതിനിധികളുടെയോ സാന്നിദ്ധ്യത്തിൽ തുറക്കുന്നതാണ്.

താൽപ്പര്യമുളളവർ ദർഘാസ് ഫോറത്തിന്റെ വിലയായ 400 രൂപ + വാറ്റ് ആഫീസിൽ അടച്ച് ലഭിക്കുന്ന ഫോറത്തിൽ ദർഘാസുകൾ നൽകണം. ദർഘാസ് ഫോറം തപാൽ വഴി ആവശ്യമുളളവർ തപാൽ ചാർജ് 50 രൂപ കൂടി ചേർത്ത് മണി ഓർഡർ അയയ്ക്കേ≠താണ്. ദർഘാസ് ഫോറങ്ങൾ മാറ്റത്തിന് വിധേയമല്ല. ഡ്യൂπിക്കേറ്റ് ഫോറത്തിന്റെ വില രൂപ 200+വാറ്റ് ആയിരിക്കും. ദർഘാസ് ഫോറത്തിന്റെ വിൽപ്പന 25-2-2009 പകൽ 2 മണിക്ക് അവസാനിക്കുന്ന താണ്. കൂടുതൽ വിവരങ്ങൾ ഓഫീസിൽനിന്നും നേരിട്ട് അറിയാവുന്നതാണ്. ക്വാട്ട് ചെയ്ത ഉപകരണത്തിന്റെ ആകെ വിലയുടെ ഒരു ശതമാനത്തിനുള്ള ഡിമാന്റ ് ഡ്രാഫ്റ്റ് നെടുങ്ക≠ത്ത് മാറത്തക്കവിധത്തിൽ പ്രിൻസിപ്പാളിന്റെ പേരിൽ എടുത്ത് നിരതദ്രവ്യമായി സമർപ്പിക്കേ≠താണ്.

അടങ്കൽ തുക—1,96,450 രൂപ.

(2)

No. A3-843/2008. 19th January 2009.

Sealed tenders are invited for the supply of Lab Equipments in Computer Hardware Maintenance Branch of Government Polytechnic College, Nedumkandam.

The tender should be superscribed No. A3-843/2008 supply of Electronics Branch Equipments in the Computer Hardware Maintenance Department of this institution and addressed with the Principal, Government Polytechnic College, Nedumkandam before 3 p.m. on 25-2-2009. Late tenders will not be accepted. Tender will be opened at 3 p. m. on 26-2-2009 in the presence of the tenderers or their representatives who may be present at that time.

Inviting tenders may on application to Principal obtain the requisite tender form on which tender should be submitted. Application for the tender form should be accompanied by a cash remittance of Rs. 400 + VAT which is fixed for a form and which is not refundable under any circumstances. Duplicate tender form will be available for cost of Rs. 200+ VAT. The tender forms are not transferable. The sale will be closed 25-2-2009 at on 2 p.m. Cheque, Postage stamps will not be accepted towards the cost of form nor will the form be sent by V.P.P. Earnest Money Deposit @ 1% of total cost of Cotton items by means of Demand Draft in favour of Principal, Government Polytechnic College, Nedumkandam.

P. A. C.—Rs. 1,26,550.

നെടുങ്ക≠ം ഗവൺമെന്റ ് പോളിടെക്നിക് കോളേജിലെ കമ്പ്യൂട്ടർ ഹാർഡ്വെയർ മെയിന്റനൻസ് ബ്രാഞ്ചി ലേക്ക് ഉപകരണങ്ങൾ വിതരണം ചെയ്യുന്നതിനായി മുദ്രവെച്ച ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

കവറിനുമുകളിൽ നമ്പർ എ3-843/2008 നെടുങ്ക≠ം ഗവൺമെന്റ ് പോളിടെക്നിക് കോളേജിൽ കമ്പ്യൂട്ടർ ഹാർഡ് വെയർ മെയിന്റനൻസ് ലാബ് ഉപകരണങ്ങൾ വിതരണം ചെയ്യുന്നതിനായി എന്നെഴുതിയ ദർഘാസ് അടക്കം ചെയ്ത കവർ പ്രിൻസിപ്പാൾ, ഗവൺമെന്റ ് പോളിടെക്നിക്് കോളേജ്, നെടുങ്ക≠ം-685 553 എന്ന വിലാസത്തിൽ 25-2-2009-ന് 3 മണിക്ക് മുമ്പായി ലഭിച്ചിരിക്കണം. വൈകിക്കിട്ടുന്ന ദർഘാസുകൾ യാതൊരു കാരണവശാലും സ്വീകരിക്കുന്നതല്ല. ദർഘാസുകൾ 26-2-2009, പകൽ 3 മണിക്ക് ഹാജരായ ദർഘാസുകാരുടെയോ അവർ അധികാരപ്പെടുത്തിയ പ്രതിനിധികളുടെയോ സാന്നിദ്ധ്യത്തിൽ തുറക്കുന്നതാണ്.

താൽപ്പര്യമുളളവർ ദർഘാസ് ഫോറത്തിന്റെ വിലയായ 400 രൂപ + വാറ്റ് ആഫീസിൽ അടച്ച് ലഭിക്കുന്ന ഫോറത്തിൽ ദർഘാസുകൾ നൽകണം. ദർഘാസ് ഫോറം തപാൽവഴി ആവശ്യമുളളവർ തപാൽ ചാർജ് 50 രൂപ കൂടി ചേർത്ത്29 മണി ഓർഡർ അയയ്ക്കേ≠താണ്. ദർഘാസ് ഫോറങ്ങൾ മാറ്റത്തിന് വിധേയമല്ല. ഡ്യൂπിക്കേറ്റ് ഫോറത്തിന്റെ വില രൂപ 200+വാറ്റ് ആയിരിക്കും. ദർഘാസ് ഫോറത്തിന്റെ വിൽപ്പന 25-2-2009, 2 മണിക്ക് അവസാനിക്കുന്നതാണ്. കൂടുതൽ വിവരങ്ങൾ ഓഫീസിൽ നിന്നും നേരിട്ട് അറിയാവുന്ന താണ്. ക്വാട്ട് ചെയ്യുന്ന ഉപകരണത്തിന്റെ ആകെ വിലയുടെ ഒരു ശതമാനത്തിനുള്ള ഡിമാന്റ ് ഡ്രാഫ്റ്റ് നെടുങ്ക≠ത്ത് മാറത്തക്കവിധത്തിൽ പ്രിൻസിപ്പാളിന്റെ പേരിൽ എടുത്ത് നിരതദ്രവ്യമായി സമർപ്പിക്കേ≠താണ്.

അടങ്കൽ തുക—രൂപ 1,26,550

(3)

No. A3-846/2008. 19th January 2009.

Sealed tenders are invited for the supply of Lab Equipments in Computer Branch of Government Polytechnic College, Nedumkandam.

The tender should be superscribed No. A3-846/2008 supply of Computer Branch Equipments in the Computer Department of this institution and address with the Principal, Government Polytechnic College, Nedumkandam before 3 p.m. on 25-2-2009. Late tenders will not be accepted. Tender will be opened at 3 p. m. on 26-2-2009 in the presence of the tenderers or their representatives who may be present at that time.

Inviting tenders may on application to Principal obtain the requisite tender form on which tender should be submitted. Application for the tender forms should be accompanied by a cash remittance of Rs. 400 + VAT which is fixed for a form and which is not refundable under any circumstances. Duplicate tender form will be available for cost of Rs. 200+ VAT. The tender forms are not transferable, sale will be closed on 25-2-2009 at 2 p.m. Cheque, Postage Stamps will not be accepted towards the cost of form nor will the form be sent by V.P.P. Earnest Money Deposit @ 1% of total cost of quoted items by means of Demand Draft in favour of Principal, Government Polytechnic College, Nedumkandam. P. A. C.—Rs. 1,72,885.

നെടുങ്ക≠ം ഗവൺമെന്റ ് പോളിടെക്നിക് കോളേജിലെ കമ്പ്യൂട്ടർ ബ്രാഞ്ചിലേക്ക് ലാബ് ഉപകരണങ്ങൾ വിതരണം ചെയ്യുന്നതിനായി മുദ്രവച്ച ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

കവറിനുമുകളിൽ നമ്പർ എ3-846/2008 നെടുങ്ക≠ം ഗവൺമെന്റ ് പോളിടെക്നിക് കോളേജിൽ കമ്പ്യൂട്ടർ ലാബ് ഉപകരണങ്ങൾ വിതരണം ചെയ്യുന്നതിനായി എന്നെഴുതിയ ദർഘാസ് അടക്കംചെയ്ത കവർ പ്രിൻസിപ്പാൾ, ഗവൺമെന്റ ് പോളിടെക്നിക്ക് കോളേജ്, നെടുങ്ക≠ം-685 553 എന്ന വിലാസത്തിൽ 25-2-2009, 3 മണിക്ക് മുമ്പായി ലഭിച്ചിരിക്കണം. വൈകിക്കിട്ടുന്ന ദർഘാസുകൾ യാതൊരു കാരണവശാലും സ്വീകരിക്കുന്നതല്ല. ദർഘാസുകൾ 26-2-2009 പകൽ 3 മണിക്ക് ഹാജരായ ദർഘാസുകാരുടെയോ അവർ അധികാരപ്പെടുത്തിയ പ്രതിനിധികളുടെയോ സാന്നിദ്ധ്യത്തിൽ തുറക്കുന്നതാണ്.

Gaz. No. 8/2009/DTP (Stores).

താൽപ്പര്യമുളളവർ ദർഘാസ് ഫോറത്തിന്റെ വിലയായ 400 രൂപ + വാറ്റ് ആഫീസിൽ അടച്ച് ലഭിക്കുന്ന ഫോറത്തിൽ ദർഘാസുകൾ നൽകണം. ദർഘാസ് ഫോറം തപാൽവഴി ആവശ്യമുളളവർ തപാൽ ചാർജ് 50 രൂപ കൂടി ചേർത്ത് മണി ഓർഡർ അയയ്ക്കേ≠താണ്. ദർഘാസ് ഫോറങ്ങൾ മാറ്റത്തിന് വിധേയമല്ല. ഡ്യൂπിക്കേറ്റ് ഫോറത്തിന്റെ വില രൂപ 200+വാറ്റ് ആയിരിക്കും. ദർഘാസ് ഫോറത്തിന്റെ വിൽപ്പന 25-2-2009 പകൽ 2 മണിക്ക് അവസാനിക്കുന്നതാണ്. കൂടുതൽ വിവരങ്ങൾ ഓഫീസിൽ നിന്നും നേരിട്ട് അറിയാവുന്നതാണ്. ക്വാട്ട് ചെയ്യുന്ന ഉപകരണത്തിന്റെ ആകെ വിലയുടെ ഒരു ശതമാനത്തിനുള്ള ഡിമാന്റ ് ഡ്രാഫ്റ്റ് നെടുങ്ക≠ത്ത് മാറത്തക്കവിധത്തിൽ പ്രിൻസിപ്പാളിന്റെ പേരിൽ എടുത്ത് നിരതദ്രവ്യമായി സമർപ്പിക്കേ≠താണ്.

അടങ്കൽ തുക—രൂപ 1,72,885.

(Sd.) Office of the Principal, Government Polytechnic Head of Section . College, Nedumkandam. (In charge of Principal).

SHORT TENDER NOTICE

No. B. 648/2008. 19th January 2009.

Sealed short tenders are invited for the supply of Computer Hardware items to the Computer Hardware Maintanance Lab of Government Polytechnic College, Meppadi. The envelop should be superscribed with "Tender Number and due date" and addressed to the office of the undersigned.

Cost of tender forms—Rs. 440 + 12.5% VAT.

Due date and time of tender—27-2-2009, 10 a. m. Last date and time of sale of tender forms—

27-2-2009, 10 a. m.

Date and time of opening of tenders—27-2-2009, 3 p. m.

The intending tenderers may on their application will get the tender forms from the office of the undersigned during the office hours. The tender should be enclosed with 1% of the total estimated tender cost. The late and incomplete tenders will not be accepted. Those who wish to obtain the tender forms through registered post should send the cost of tender forms and Rs. 30 for postal charges. The details regarding the tender may be had from this office on working hours.

മേപ്പാടി സർക്കാർ പോളിടെക്നിക്ക് കോളേജിലെ കമ്പ്യൂട്ടർ ഹാർഡ്വെയർ ലാബിലേക്ക് കമ്പ്യൂട്ടർ ഹാർഡ് വെയർ ഉപകരണങ്ങൾ വിതരണം ചെയ്യുന്ന തിലേക്കായി മുദ്രവച്ച കവറിൽ ദർഘാസുകൾ ക്ഷണിച്ചു കൊളളുന്നു. കവറിനു പുറത്ത് ദർഘാസ് നമ്പരും തീയതിയും നിർബന്ധമായും സൂചിപ്പിക്കേ≠താണ്. ദർഘാസുകൾ സ്വീകരിക്കുന്ന അവസാന തീയതിക്കകം, പൂരിപ്പിച്ച ദർഘാസുകൾ പ്രിൻസിപ്പാൾ, സർക്കാർ പോളിടെക്നിക്ക് കോളേജ്, മേപ്പാടി എന്ന വിലാസത്തിൽ ലഭിക്കേ≠താണ്.

ദർഘാസുകൾ ആവശ്യമുള്ള സ്ഥാപനങ്ങൾക്കും വ്യ‡ികൾക്കും ദർഘാസ് വില ഓഫീസിൽ അടച്ച് കൈപ്പറ്റാവുന്നതാണ്. തപാൽ മുഖേന ദർഘാസുകൾ ആവശ്യമുള്ളവർ ദർഘാസ് വിലയോടൊപ്പം തപാൽ ചാർ÷് 30 രൂപ കൂടി മണിയോർഡർ അയച്ചാൽ മടക്ക തപാലിൽ ദർഘാസുകൾ അയച്ചുതരുന്നതാണ്. ദർഘാസിനോടൊപ്പം മൊത്തം ദർഘാസ് സംഖ്യയുടെ ഒരു ശതമാനം നിരതദ്രവ്യ മായി സമർപ്പിക്കേ≠താണ്. അപൂർണ്ണവും വൈകിക്കി ട്ടുന്നതുമായ ദർഘാസുകൾ സ്വീകരിക്കുന്നതല്ല. ദർഘാസുകൾ താഴെ സൂചിപ്പിച്ച തീയതിയിൽ പ്രിൻസിപ്പാളിന്റെ ഓഫീസിൽ വച്ച് തുറക്കുന്നതായിരിക്കും.

ദർഘാസ് തീയതി—19-1-2009

ദർഘാസ് ഫോറം വിൽക്കുന്ന അവസാന തീയതിയും സമയവും —27-2-2009, 10 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—27-2-2009, 3 മണി.

The tender should be superscribed No. D1/2631/2008 addressed to the Principal, Government College of Engineering, P. O. Parassinikadavu, Kannur-670 563. Last date and time of receipt of tender is 1-3-2009 at 4 p. m. and the tender will be opened at 11 a. m. on 2-3-2009 in the presence of such of the tenderers or authorised representatives who may be present at that time. Late tenders will not be accepted.

Intending tenderers may on application to the Principal, Government College of Engineering, P. O. Parassinikadavu, Kannur-670 563 obtain the requisite tender forms on which tenders should be submitted. Application for the tender forms should be accompanied by a cash remittance of Rs. 450 which is the price fixed for a form/set of forms and which is not refundable under any circumstances. The tender forms are not transferable. Sale of tender forms will be closed at 3 p. m. on 1-3-2009.

Current

Items

Sl. No.

Requirements

Nos.

1 Intel DG31PR Motherboard 5 2 Intel Core 2 Duo E4600 2.53 Ghz 5 3 DDR II 2GB 5 4 HDD 160 GB SATA 5 5 DVD Writer 20x 5 6 ATX Cabinet with Front USB and 5 Audio

7 All in One Card reader Drive Type 5 8 Webcam Day and Night Model 5 9 Monitor 15" TFT 5 10 Speaker Stereo

5 11 Keyboard Logitech Normal USB 5 12 Mouse Logitech USB Optical Normal 5 13 Dotmatrix Printer 24 Pin in 136

Colum 300 cps with Colour 1 14 Vaccum cleaner

1 15 External DVD Writer (USB) 1 Government Polytechnic College, (Sd.) Meppadi, Wayanad. Principal.

Cheques, Postage Stamps, D. D., I. P. O. etc. will not be accepted towards the cost of forms, nor will the forms be sent by V. P. P. Duplicate forms, if required will be issued at Rs. 225 per copy.

Those who want tender form by post should sent an additional amount of Rs. 27 towards the postal charge.

കണ്ണൂർ ഗവൺമെന്റ ് എഞ്ചിനീയറിംഗ് കോളേജിലെ സിവിൽ എഞ്ചിനീയറിംഗ് വിഭാഗത്തിലെ ട്രാൻസ്പോർട്ടേഷൻ എഞ്ചിനീയറിംഗ് ലാബിലേക്കാവശ്യമായ സാധനങ്ങൾ വിതരണം ചെയ്യുന്നതിന് മുദ്രണം ചെയ്ത ദർഘാസുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

മുദ്രണം ചെയ്ത ദർഘാസുകൾ പ്രിൻസിപ്പാൾ, ഗവൺമെന്റ ് എഞ്ചിനീയറിംഗ് കോളേജ്, കണ്ണൂർ-670 563 എന്ന വിലാസത്തിൽ 1-3-2009-ന് വൈകുന്നേരം 4 മണിക്ക് മുമ്പായി ലഭിക്കേ≠താണ്. നി›ിത സമയത്തിനും തീയതിക്കുമകം ലഭിക്കുന്ന മുദ്രണം ചെയ്ത ദർഘാസുകൾ 2-3-2009-ന് രാവിലെ 11 മണിക്ക് ഹാജരായിട്ടുള്ള അംഗീകൃത പ്രതിനിധികളുടെ സാന്നിദ്ധ്യത്തിൽ തുറക്കുന്നതാണ്.

ദർഘാസ് ഫോറങ്ങൾ ആവശ്യമുള്ള വ്യ‡ികൾ/ സ്ഥാപനങ്ങൾ പ്രിൻസിപ്പാൾ, ഗവൺമെന്റ ് എഞ്ചിനീയറിംഗ് കോളേജ്, കണ്ണൂർ-670 563 എന്ന വിലാസത്തിൽ 450 രൂപ അടച്ച് അപേക്ഷിച്ചാൽ ദർഘാസ് ഫാറങ്ങൾ ലഭിക്കുന്നതാണ്. തനിപ്പകർപ്പുകൾ ആവശ്യമുള്ളവർ 225 രൂപ അടച്ച് കൈപ്പറ്റാ വുന്നതാണ്. ദർഘാസ് ഫാറത്തിന്റെ വില ചെക്ക്/ഡി. ഡി./ പോസ്റ്റേജ് സ്റ്റാമ്പ്/എെ. പി. ഒ. എന്നിവ മുഖേന അടയ്ക്കാവു ന്നതല്ല. വി. പി. പി. അനുവദനീയമല്ല. ദർഘാസ് ഫാറങ്ങൾ 1-3-2009-ന് ഉച്ചയ്ക്ക് 3 മണിവരെ കൈപ്പറ്റാവുന്ന താണ്.

Sl.

Items and Specification

SHORT TENDER NOTICE

No.

Quantity

Nos.

No. D1/2631/2008. 20th January 2009.

Sealed tenders are invited for the supply of certain items for Transportation Engineering Lab of Government Engineering College, Kannur.

Approximate Cost— Rs. 2,40,000,

E. M. D.—1% of quoted value.

(1) (2)

(3) 1 IS Sieve-size-125 mm 1 2 IS Sieve-size-90 mm 1 IS Sieve-size-75 mm 1 IS Sieve-size-53 mm 131 (1) (2)

IS Sieve-size-45 mm 1 IS Sieve-size-37.5 mm 1 IS Sieve-size-26.5 mm 1 IS Sieve-size-19 mm 1 IS Sieve-size-13.2 mm 1 IS Sieve-size-9.5 mm 1 IS Sieve-size-3.35 mm 1 IS Sieve-size-2.8 mm 1 IS Sieve-size-1.18 mm 1 IS Sieve-size-1.14 mm 1 IS Sieve-size-0.850 mm 1 IS Sieve-size-0.710 mm 1 IS Sieve-size-0.600 mm 1 IS Sieve-size-0.425 mm 1 IS Sieve-size-0.355 mm 1 IS Sieve-size-0.300 mm 2 IS Sieve-size-0.212 mm 1 IS Sieve-size-0.180 mm 1 IS Sieve-size-0.150 mm 1 IS Sieve-size-0.090 mm 1 IS Sieve-size-0.075 mm 2 2 Sievesbaker with adapter

(Course and Fine) 1 3 Stop Watch

1 4 Tar Thermometer 1

(3) (1) (2)

(3) (2) A container for filling water and 1 suspending the basket.

(3) An air tight container of capacity similar to that of the basket [referre to in (1)]

9 Electronic balance 20 kg. capacity and

accurate up to 1g. pan size 290 x 210. 1 10 Electronic balance 3 kg. capacity and accurate up to 0.1 g. pan size 116 mm dia.

1 11 Spatula 150 mm blade with wooden

handle

2 12 Heat resistance glove 2 13 Crucible tongs straight 200 mm long 2 14 Sample tray (enamel tray), size 6.50 ×

500 × 50 mm 2 15 Sample tray (enamel tray), size 450 ×

300 × 40 mm 2 16 Beaker (glass) graduated 100 ml size 2 17 Desicater non vaccum type, 200 mm

dia (glass)

2 18 Thermometer (range 0 to 250 C ) 1 19 Filter papers-whatman filter

No. 40/41/42 dia. 110 mm (box of 100) 1 20 Extension chord box length of chord

5 m. containing 3 three pin plug 5 21 Marshalstability apparatus 50 KN capacity with all accessories (proving ring above 2.5 KN, Dial guage etc.) 1 Government Engineering College, (Sd.) Kannur.

Principal.

5 Straight metal tamping red of circular cross section 16 mm dia and 45 to 60 cm long, rounded at one end. 2 Department of Vocational Higher Secondary Education

6 Laboratory Electric oven, thermostati- cally, Controlled range 50 C to 250 C with air circulating fan, stainless steel, inside size 600 x 900 x 600 mm 1 7 All accessories of angularity number experiment such as 1 (1) Metal cylinder closed at one end and of about 3 lit. capacity, 15.64 cm dia 15.6, 4 cm height

(2) Metal Scoop of about one bit. heaped capacity of size 20 x 10 x 5 8 All the accessories of specific gravity test such as

1 (1) A wire basket of not more than 6.3 mm mesh or a performed container with thin wire hangers for suspen- ding it from the balance.

SHORT TENDER NOTICE

[1/2008-09]

No. 47/2009 (1). 27th January 2009.

Sealed and competitive tenders are invited from reputed firms for the supply of equipments to Biology and Agriculture Laboratories of G. V. H. S. S. Technical High School, Palakkad.

Earned Money Depost—1% of the quoted value by means of DD form the Nationalised Bank.

Cost of tender form :

Original—Rs. 450 + ST.

Duplicate—Rs. 225 + ST.

Last date and time of issue of tender form—

2-3-2009, 10 a. m.

സർക്കാർ വി.എച്ച്.എസ്.എസ്./ടെക്നിക്കൽ ഹൈസ്കൂളിലെ ബയോളജി, അഗ്രിക്കൾച്ചർ ലാബ് ഉപകരണ ങ്ങൾ വാങ്ങുന്നതിന് പ്രശസ്ത സ്ഥാപനങ്ങളിൽ നിന്ന് മുദ്രവച്ച ടെ≠റുകൾ ക്ഷണിച്ചുകൊള്ളുന്നു.

Last date and time of receipt of tender form—

നിരതദ്രവ്യം—തുകയുടെ ഒരു ശതമാനം. 2-3-2009, 2 p. m.

ദർഘാസ് ഫോറത്തിന്റെ വില (നികുതി ഉൾപ്പെടെ):

Date and time of opening of tenders—2-3-2009, 3 p. m.

അസ്സൽ—രൂപ 450. പകർപ്പ്—രൂപ 225.

The tenders should be accompanied by an agreement

ദർഘാസ് ഫോറം വിതരണം ചെയ്യുന്ന അവസാന executed in the Kerala Stamp Paper worth Rs. 50. The

തീയതിയും സമയവും—2-3-2009, രാവിലെ 10 മണി.

tenders without tender form, agreement,

ദർഘാസുകൾ സ്വീകരിക്കുന്ന അവസാന തീയതിയും EMD will be rejected.

സമയവും—2-3-2009 2 മണി.

ദർഘാസ് തുറക്കുന്ന തീയതിയും സമയവും—2-3-2009 Intending tenderers may obtain the requisite non

വൈകുന്നേരം 3 മണി.

transferable tender forms separately for each requirement

from the Principal, G.V.H.S.S./Technical High School,

Palakkad on payment of value noted above by cash or by

Money Order (Postage Rs. 50 Extra). The cost of tender

forms will be accepted by means of cash or Money Order

only.

Tenders should be clearly superscribed. The same

50 രൂപയുടെ കേരള സർക്കാർ മുദ്രപ്പത്രത്തിൽ തയ്യാറാക്കിയിട്ടുള്ള സമ്മതപത്രം ദർഘാസിനോടൊപ്പം സമർപ്പിക്കേ≠താണ്. വൈകി കിട്ടുന്ന ദർഘാസുകൾ പരിഗണിക്കുന്നതല്ല. താല്പര്യമുള്ളവർക്ക് കൈമാറ്റം ചെയ്യാനാവാത്ത ദർഘാസുകൾ ഓരോന്നിനും പ്രത്യേകമായി ഓഫീസിൽ പണമടച്ചാൽ നേരിട്ടോ മണിയോർഡർ മുഖേനയോ മാത്രം ലഭിക്കുന്നതാണ്. (തപാൽ കൂലി 50 രൂപ പ്രത്യേകം) ദർഘാസുകൾ നി›ിത സമയത്തും തീയതിയിലും തദവസരത്തിൽ സാന്നിദ്ധ്യമുള്ള ദർഘാസുകാരുടെ മുന്നിൽവച്ച് തുറക്കുന്നതാണ്. നിരതദ്രവ്യവും സമ്മതപത്രവും ഇല്ലാത്ത ദർഘാസുകൾ സ്വീകരിക്കുന്നതല്ല.

will be opened on the specific date and time in the

presence of such tenderers or their authorized

representatives. Late tenders will not be considered.

V.H.S.S., Technical High School, (Sd.) Palakkad.

Principal.